Regulation of Lipid Metabolism Genes, Lipid Carrier Protein Lipophorin, and Its Receptor during Immune Challenge in the Mosquito Aedes aegypti

In the mosquito Aedes aegypti, the expression of two fat body genes involved in lipid metabolism, a lipid carrier protein lipophorin (Lp) and its lipophorin receptor (LpRfb), was significantly increased after infections with Gram (+) bacteria and fungi, but not with Gram (–) bacteria. The expression of these genes was enhanced after the infection with Plasmodium gallinaceum. RNA interference (RNAi) knockdown of Lp strongly restricted the development of Plasmodium oocysts, reducing their number by 90%. In Vg-ΔREL1-A transgenic mosquitoes, with gain-of-function phenotype of Toll/REL1 immune pathway activated after blood feeding, both the Lp and LpRfb genes were overexpressed independently of septic injury. The same phenotype was observed in the mosquitoes with RNAi knockdown of Cactus, an IκB inhibitor in the Toll/REL1 pathway. These results showed that, in the mosquito fat body, both Lp and LpRfb gene expression were regulated by the Toll/REL1 pathway during immune induction by pathogen and parasite infections. Indeed, the proximal region of the LpRfb promoter contained closely linked binding motifs for GATA and NF-κB transcription factors. Transfection and in vivo RNAi knockdown experiments showed that the bindings of both GATA and NF-κB transcription factors to the corresponding motif were required for the induction of the LpRfb gene. These findings suggest that lipid metabolism is involved in the mosquito systemic immune responses to pathogens and parasites. In the mosquito Aedes aegypti, the expression of two fat body genes involved in lipid metabolism, a lipid carrier protein lipophorin (Lp) and its lipophorin receptor (LpRfb), was significantly increased after infections with Gram (+) bacteria and fungi, but not with Gram (–) bacteria. The expression of these genes was enhanced after the infection with Plasmodium gallinaceum. RNA interference (RNAi) knockdown of Lp strongly restricted the development of Plasmodium oocysts, reducing their number by 90%. In Vg-ΔREL1-A transgenic mosquitoes, with gain-of-function phenotype of Toll/REL1 immune pathway activated after blood feeding, both the Lp and LpRfb genes were overexpressed independently of septic injury. The same phenotype was observed in the mosquitoes with RNAi knockdown of Cactus, an IκB inhibitor in the Toll/REL1 pathway. These results showed that, in the mosquito fat body, both Lp and LpRfb gene expression were regulated by the Toll/REL1 pathway during immune induction by pathogen and parasite infections. Indeed, the proximal region of the LpRfb promoter contained closely linked binding motifs for GATA and NF-κB transcription factors. Transfection and in vivo RNAi knockdown experiments showed that the bindings of both GATA and NF-κB transcription factors to the corresponding motif were required for the induction of the LpRfb gene. These findings suggest that lipid metabolism is involved in the mosquito systemic immune responses to pathogens and parasites. Lipophorin (Lp) 2The abbreviations used are: Lp, lipophorin; LpR, lipophorin receptor; Dif, Dorsal-related immune factor; LDLR, low density lipoprotein receptor; PBM, post-blood meal; RFABG, retinoid and fatty-acid binding gene; RNAi, RNA interference; dsRNA, double strand RNA; EMSA, electrophoretic mobility shift assay. 2The abbreviations used are: Lp, lipophorin; LpR, lipophorin receptor; Dif, Dorsal-related immune factor; LDLR, low density lipoprotein receptor; PBM, post-blood meal; RFABG, retinoid and fatty-acid binding gene; RNAi, RNA interference; dsRNA, double strand RNA; EMSA, electrophoretic mobility shift assay. is the major lipid carrier protein in insects. It delivers lipids to various organs via the hemolymph as a reusable shuttle, with no concomitant degradation of the protein matrix of the Lp particle. The fat body, which is an insect analog of vertebrate liver and adipose tissue combined, plays a key role in lipid metabolism by being the site of lipid storage and mobilization. The loading and unloading of lipids into and from fat body cells is accomplished by a shuttle mechanism involving Lp and a multiprotein complex called a lipid transfer particle. The lipophorin particle consists of three apolipoproteins: apolipoprotein I, apolipoprotein II, and apolipoprotein III (1Law J.H. Wells M.A. J. Biol. Chem. 1989; 264: 16335-16338Abstract Full Text PDF PubMed Google Scholar, 2Ryan R.O. Van der Horst D.J. Annu. Rev. Entomol. 2000; 45: 233-260Crossref PubMed Scopus (156) Google Scholar, 3Arrese E.L. Canavoso L.E. Jouni Z.E. Pennington J.E. Tsuchida K. Wells M.A. Insect Biochem. Mol. Biol. 2001; 31: 7-17Crossref PubMed Scopus (193) Google Scholar). ApoLpI and apoLpII are encoded by a single gene (4Kutty R.K. Kutty G. Kambadur R. Duncan T. Koonin E.V. Rodriguez I.R. Odenwald W.F. Wiggert B. J. Biol. Chem. 1996; 34: 20641-20649Abstract Full Text Full Text PDF Scopus (69) Google Scholar, 5Sundermeyer K. Hendricks J.K. Prasad S.V. Wells M.A. Insect Biochem. Mol. Biol. 1996; 26: 735-738Crossref PubMed Scopus (41) Google Scholar, 6Babin P.J. Bogerd J. Kooiman F.P. Van Marrewijik W.J. Van der Horst D.J. J. Mol. Evol. 1999; 49: 150-160Crossref PubMed Scopus (173) Google Scholar). Likewise, mosquito Aedes aegypti Lp consists of apoLpI and apoLpII, the mRNAs of which originate from a single large precursor RNA, indicating that they are encoded by the same gene. Aedes Lp protein level increases upon ingestion of a blood meal, when the mosquito needs an increased rate of lipid transport to developing oocytes. Lipophorin in the whole bodies reaches its maximal levels by 40–48 h post-blood meal (PBM) when major events of egg yolk and lipid deposition have been completed. However, Lp mRNA and the rate of Lp synthesis in the fat body reach their maximal levels at 18–20 h PBM (7Capurro M de L. de Bianchi A.G. Marinotti O. Comp. Biochem. Physiol. 1994; 108: 35-39Google Scholar, 8Van Heusden M.C. Thompson F. Dennis J. Insect Biochem. Mol. Biol. 1998; 28: 733-738Crossref PubMed Scopus (34) Google Scholar, 9Van Heusden M.C. Erickson B.A. Pennington J.E. Arch. Insect Biochem. Physiol. 1997; 34: 301-312Crossref PubMed Scopus (16) Google Scholar, 10Sun J. Hiraoka T. Dittmer N.T. Cho K.H. Raikhel A.S. Insect Biochem. Mol. Biol. 2000; 30: 1161-1171Crossref PubMed Scopus (67) Google Scholar).The intracellular uptake of Lp is mediated by its cognate lipophorin receptor (LpR), which belongs to the superfamily of low density lipoprotein receptors (LDLRs) (11Dantuma N.P. Potters M. de Winther M.P. Tensen C.P. Kooiman F.P. Bogerd J. van der Horst D.J. J. Lipid Res. 1999; 40: 973-978Abstract Full Text Full Text PDF PubMed Google Scholar, 12Van Hoof D. Rodenburg K.W. van der Horst D.J. J. Cell Sci. 2002; 115: 4001-4012Crossref PubMed Scopus (41) Google Scholar, 13Van Hoof D. Rodenburg K.W. van der Horst D.J. J. Lipid Res. 2003; 44: 1431-1440Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar, 14Cheon H.M. Seo S.J. Sun J. Sappington T.W. Raikhel A.S. Insect Biochem. Mol. Biol. 2001; 31: 753-760Crossref PubMed Scopus (78) Google Scholar, 15Seo S.J. Cheon. H.M. Sun J. Sappington T.W. Raikhel A.S. J. Biol. Chem. 2003; 278: 41954-41962Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). LpRs have been cloned from several insects, including Locusta migratoria (11Dantuma N.P. Potters M. de Winther M.P. Tensen C.P. Kooiman F.P. Bogerd J. van der Horst D.J. J. Lipid Res. 1999; 40: 973-978Abstract Full Text Full Text PDF PubMed Google Scholar), A. aegypti (14Cheon H.M. Seo S.J. Sun J. Sappington T.W. Raikhel A.S. Insect Biochem. Mol. Biol. 2001; 31: 753-760Crossref PubMed Scopus (78) Google Scholar, 15Seo S.J. Cheon. H.M. Sun J. Sappington T.W. Raikhel A.S. J. Biol. Chem. 2003; 278: 41954-41962Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar), and Galleria mellonella (16Lee C.S. Han J.H. Kim B.S. Lee S.M. Hwang J.S. Kang S.W. Lee B.H. Kim H.R. Insect Biochem. Mol. Biol. 2003; 33: 761-771Crossref PubMed Scopus (35) Google Scholar). Previously, we have identified two splice variants of A. aegypti LpR gene products specific to the fat body (AaLpRfb) and ovary (AaLpRov) (14Cheon H.M. Seo S.J. Sun J. Sappington T.W. Raikhel A.S. Insect Biochem. Mol. Biol. 2001; 31: 753-760Crossref PubMed Scopus (78) Google Scholar, 15Seo S.J. Cheon. H.M. Sun J. Sappington T.W. Raikhel A.S. J. Biol. Chem. 2003; 278: 41954-41962Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). The expression of the fat body-specific AaLpRfb transcript is restricted to the postvitellogenic period, during which production of yolk protein precursors is terminated and the fat body is transformed into a storage depot of lipid, carbohydrate, and protein (15Seo S.J. Cheon. H.M. Sun J. Sappington T.W. Raikhel A.S. J. Biol. Chem. 2003; 278: 41954-41962Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). In the mosquito fat body, the regulation of expression of most genes involved in vitellogenesis is governed through a blood meal-driven hormonal cascade, with the terminal signal being a steroid, 20-hydroxyecdysone (17Raikhel A.S. Kokoza V.A. Zhu J. Martin D. Wang S.F. Li C. Sun G. Ahmed A. Dittmer N. Attardo G. Insect Biochem. Mol. Biol. 2002; 32: 1275-1286Crossref PubMed Scopus (173) Google Scholar). Transcription of the LDLR gene in the animal cells is regulated by intracellular cholesterol concentration, hormones, and growth factors (18Streicher R. Kotzka J. Muller-Wieland D. Siemeister G. Munck M. Avci H. Krone W. J. Biol. Chem. 1996; 271: 7128-7133Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). In the mosquito, a rising Lp titer and/or a falling titer of 20-hydroxyecdysone could serve as signals activating transcription of the AaLpRfb gene (10Sun J. Hiraoka T. Dittmer N.T. Cho K.H. Raikhel A.S. Insect Biochem. Mol. Biol. 2000; 30: 1161-1171Crossref PubMed Scopus (67) Google Scholar, 14Cheon H.M. Seo S.J. Sun J. Sappington T.W. Raikhel A.S. Insect Biochem. Mol. Biol. 2001; 31: 753-760Crossref PubMed Scopus (78) Google Scholar, 15Seo S.J. Cheon. H.M. Sun J. Sappington T.W. Raikhel A.S. J. Biol. Chem. 2003; 278: 41954-41962Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar).In addition to its role in providing energy for various physiological processes, lipid metabolism has been implicated in infectious and parasitic diseases (19Bansal D. Bhatti H.S. Sehgal R. Lipids Health Disease. 2005; 4: 1-7Crossref PubMed Scopus (80) Google Scholar). Lipid carrier proteins have been reported to reduce the toxicity of lipopolysaccharide in both invertebrates (20Kato Y. Motoi Y. Taniai K. Kadonookuda K. Hiramatsu M. Yamakawa M. Insect Biochem. Mol. Biol. 1994; 24: 539-545Crossref Scopus (42) Google Scholar, 21Kitchens R.L. Wolfbauer G. Albers J.J. Munford R.S. J. Biol. Chem. 1999; 274: 34116-34122Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar) and mammals (22Kato Y. Motoi Y. Taniai K. Kadonookuda K. Yamamoto M. Higashino Y. Shimabukuro M. Chowdhury S. Xu J.H. Sugiyama M. Hiramatsu M. Yamakawa M. Insect Biochem. Mol. Biol. 1994; 24: 547-555Crossref PubMed Scopus (72) Google Scholar, 23Feingold K.R. Funk J.L. Moser A.H. Shigenaga J.K. Rapp J.H. Grunfeld C. Infect. Immun. 1995; 63: 2041-2046Crossref PubMed Google Scholar). Lipophorins have been described to be components of the wound-response clot Periplaneta (24Coodin S. Caveney S. J. Insect Physiol. 1992; 38: 853-862Crossref Scopus (37) Google Scholar) and Galleria (25Mandato C.A. Diehljones W.L. Downer R.G.H. J. Insect Physiol. 1996; 42: 143-148Crossref Scopus (33) Google Scholar). Several studies have suggested that another component of the insect lipid transport system, the exchangeable apoLpIII, plays a role in immunological responses (26Halwani A.E. Dunphy G.B. Dev. Comp. Immunol. 1999; 23: 563-570Crossref PubMed Scopus (72) Google Scholar, 27Halwani A.E. Niven D.F. Dunphy G.B. J. Invertebr. Pathol. 2000; 76: 233-241Crossref PubMed Scopus (87) Google Scholar, 28Dettloff M. Kaiser B. Wiesner A. J. Insect Physiol. 2001; 47: 789-797Crossref PubMed Scopus (51) Google Scholar, 29Mullen L. Goldsworthy G.J. Insect Biochem. Mol. Biol. 2003; 33: 661-670Crossref PubMed Scopus (61) Google Scholar, 30Whitten M.M. Tew I.F. Lee B.L. Ratcliffe N.A. J. Immunol. 2004; 172: 2177-2185Crossref PubMed Scopus (180) Google Scholar, 31Kim H.J. Je H.J. Park S.Y. Lee I.H. Jin b.R. Yun H.K. Yun C.Y. Han Y.S. Kang Y.J. Seo S.J. Insect Biochem. Mol. Biol. 2004; 34: 1011-1023Crossref PubMed Scopus (56) Google Scholar). Interestingly, the human exchangeable apolipoprotein E, a constituent of LDL, has also been implicated in immunomodulatory effects; apoE-deficient knock-out mice possess altered immune responses (32Laskowitz D.T. Lee D.M. D'Schmechel D. Staats H.F. J. Lipid Res. 2000; 41: 613-620Abstract Full Text Full Text PDF PubMed Google Scholar) and are more susceptible to bacterial infections than wild-type mice (33De Bont N.M. Netea G. Demacker P.N.M. Verschueren I. Kullberg B.J. Van Dijk W. Van den Meer J.W.M. Stalenhoef A.F.H. J. Lipid Res. 1999; 40: 680-685Abstract Full Text Full Text PDF PubMed Google Scholar). Recent evidence shows that a retinoid and fatty-acid binding protein (RFABG) is up-regulated in the midgut of Anopheles gambiae during infection by Plasmodium and is important for the parasite development (34Vlachou D. Schlegelmilch T. Christophides G.K. Kafatos F.C. Curr. Biol. 2005; 15: 1185-1195Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar).In this study, we systematically investigated the responses of two genes associated with lipid metabolism, Lp and LpR, during pathogen and parasite infections in the mosquito A. aegypti. We showed that, in the fat body, the tissue of insect systemic immunity and metabolism, Lp and LpRfb gene expression were up-regulated as a result of infection and regulated by the Toll/REL1 pathway. The results of this study have shed further light on the link between the lipid metabolism and immunity and infection in these vectors of major human diseases.EXPERIMENTAL PROCEDURESInsects—The mosquitoes, A. aegypti, were maintained in laboratory culture as described previously (35Hays A.R. Raikhel A.S. Roux's Arch. Dev. Biol. 1990; 199: 114-121Crossref Scopus (87) Google Scholar). Adults were provided with water and a 10% sucrose solution. Vitellogenesis was initiated by feeding females, 3–5 days after eclosion, with a blood meal from rats. All dissections were performed in Aedes physiological saline (36Hagedorn H.H. Turner S. Hagedorn E.A. Pontecorvo D. Greenbaum P. Pfeiffer D. Wheelock G. Flanagan T.R. J. Insect Physiol. 1977; 23: 203-206Crossref PubMed Scopus (131) Google Scholar).RNA Extraction, Reverse Transcription, and Real-time PCR—Dissected fat bodies from abdomens of 10–15 individual mosquitoes were homogenized using a motor-driven pellet pestle mixer (Kontes, Vineland, NJ) and lysed by TRIzol reagent (Invitrogen). RNA was isolated following the manufacturer's protocol. Contaminating genomic DNA was removed by treatment with RNase-free DNase I (Invitrogen). Reverse transcription was carried out using an Ominiscript reverse transcriptase kit (Qiagen) in a 20-μl reaction mixture containing oligo(dT) primers and 2 μg of total RNA at 37 °C for 1 h. Real-time PCR was performed using the iCycler iQ system (Bio-Rad), and reactions were performed in 96-well plates with a Quanti-Tect SYBR PCR kit (Qiagen). To quantify relative gene expression, standard curves were generated using 10-fold serial dilution of cDNA pools containing high concentrations of the gene of interest. The protocol for amplifying the cDNA product was 40 cycles of 95 °C for 30 s, then 59 °C for 45 s, followed by melting curve analysis to detect specific product amplification. Each sample was analyzed in triplicate and normalized to the internal control, β-actin mRNA. Real-time data were collected by the iCycler iQ Real-Time Detection System software version 3.0 for Windows. Raw data were exported to Excel (Microsoft, Seattle, WA) for analysis. Real-time PCR primers are as follows: LpR forward primer, CGAAAGTCAGTGCAAGTTCATCAG; LpR reverse primer, CTGGCTTCGGTCCCTTCTGAG; Lp forward primer, CAGCCAGAACAATGTGGGTAAGCTC; Lp reverse primer, GACCTTACGTGCGAGCAACTTGTTC; Actin forward primer, GACTACCTGATGAAGATCCTGAC; and Actin reverse primer, GCACAGCTTCTCCTTAATGTCAC.Synthesis and Microinjection of dsRNA—Synthesis of dsRNA was accomplished by simultaneous transcription of both strands of template DNA with a HiScribe RNAi Transcription Kit (New England Biolabs). The plasmid LITMUS 28iMal containing a nonfunctional portion of the Escherichia coli male gene that encodes maltose-binding protein was used to generate control dsRNA. After RNA synthesis, the samples were treated by phenol/chloroform extraction and ethanol precipitation. The dsRNA was then suspended in diethyl pyrocarbonate-treated distilled water with a final concentration of 5 μg/μl. The formation of dsRNA was confirmed by running 0.2 μl of these reactions in a 1.0% agarose gel in TBE (90 mm Tris borate//2 mm EDTA, pH 8.0). A Picospritzer II (General Valve, Fairfield, NJ) was used to introduce 200 nl of this dsRNA into the thorax of CO2-anesthetized mosquito females at 2–3 days post-eclosion.Septic Injury and Infection Experiments—Septic injuries were performed by pricking mosquitoes in the rear part of the abdomen with an acupuncture needle dipped into either bacterial culture or a fungal spore suspension. Plasmodium gallinaceum is routinely maintained in the laboratory by natural sporozoite transmission between the A. aegypti RED strain and chicks. One-week-old birds are infected by exposure to infected mosquitoes. The parasitemia was monitored daily on thin Giemsa-stained blood smears from 1 week after the infection until a gametocytemia range of 1–3% was reached. For the infections, 4-day-old female mosquitoes were fed on anesthetized chicken that had been infected with P. gallinaceum 9 days previously. To determine parasite oocyst development, midguts were dissected 7 days post-infection and then stained with 1% mercurochrome. Parasite oocyst numbers were determined by means of light microscopy (Nikon E400, Japan).Western Blotting Analysis—SDS-PAGE and Western blot analysis were conducted as described previously (35Hays A.R. Raikhel A.S. Roux's Arch. Dev. Biol. 1990; 199: 114-121Crossref Scopus (87) Google Scholar). Proteins were resolved on 4–12% SDS-PAGE, followed by electroblotting, to polyvinylidene difluoride membranes (Invitrogen). The membranes were probed with AaLp and β-actin (Sigma) antibodies. Immune complexes were visualized by the addition of SuperSignal WestDura Extended-Duration Substrate (Pierce).Isolation of the 5′ Upstream Region of the Fat Body-specific LpR Gene— To clone the 5′ upstream region of the LpRfb gene, a Vectorette library was constructed in accordance with the instructions provided by the manufacturer (Vectorette II, Sigma Genosys Ltd.). Genomic DNA was digested by restriction enzyme ClaI and then ligated with the corresponding Vectorette units to the digested end of the DNA. A PCR was performed using universal Vectorette and specific primers from the Vectorette library. The Vectorette amplicons were then subcloned and sequenced.Electrophoretic Gel Mobility Shift Assay—Each protein was synthesized by a coupled in vitro transcription-translation (TnT) system (Promega). The corresponding cDNA clones were subcloned into pcDNA3.1/Zeo (+) (Invitrogen). The in vitro transcription-translation reactions programmed by the circular plasmid DNA utilized the T7 promoter. To confirm the synthesis of proteins with expected size, the control TnT reactions of each protein were performed in the presence of [35S]methionine, and the resulting reactions were analyzed by means of SDS-PAGE and autoradiography. The annealed deoxyoligonucleotide of NF-κB and GATA motifs were purified from 15% TBE Criterion Precast Gel (Bio-Rad), and labeling of double-stranded oligonucleotides and EMSA was performed with a gel-shift assay system (Promega). The protein-DNA complex was separated on 5% TBA Criterion Precast Gel (Bio-Rad) and visualized by means of autoradiography.Cell Culture and Transient Transfection Assay in the Aag-2 Cell Line— Cell line Aag-2 from A. aegypti (37Fallon A.M. Sun D. Insect Biochem. Mol. Biol. 2001; 31: 263-278Crossref PubMed Scopus (60) Google Scholar) was maintained in Schneider medium (Invitrogen) supplemented with 10% fetal bovine serum (HyClone). The coding region sequences of the AaREL1-A, AaREL1-B, AaREL2, and AaGATAa were inserted into the pAc5.1/V5/HisA (Invitrogen) vector. The LpR2.4 kb promoter was inserted into pGL3/firefly luciferase vector (Promega) to form the reporter construct pLpR2.4-luc. Cells were incubated at 26 °C until they reached at least 70% confluency (∼24 h). Transfection was conducted using Effectin (Qiagen) with an optimal DNA-lipid ratio of 1:25 (w/v), following the manufacturer's instructions. Typically, 150 ng each of pLpR2.4-luc, AaREL1, AaGATAa, and pRLCMV/Renilla luciferase (Promega) were mixed in a 24-well plate with a total volume of 250 μl of growth medium and then incubated at room temperature for 20 min. The expression vector pAc5.1/V5/HisA was used as carrier DNA so that each well received an equal amount of total DNA. Renilla luciferase served as an internal control for transfection efficiency. The cells transfected with empty expression vectors pAv5.1/V5/HisA were used as a negative control. The transfection mixture was added to Aag2 cells for 6 h at 27°C. Transfection mixtures were then removed and replaced with fresh growth media. After 48 h of incubation, the medium was aspirated, and the cells were lysed in 100 μl of passive lysis buffer (Promega). Dual luciferase activities were measured using Lumimark (Bio-Rad). The relative luciferase activity was obtained by normalization of the firefly luciferase activity against Renilla luciferase activity.RESULTSThe Effect of Bacterial and Fungal Infection on Lp and LpR Gene Expression—To investigate whether A. aegypti Lp gene expression was affected as a result of infection, we measured its transcript levels after infections with Gram (–) bacterium Escherichia cloacae, Gram (+) bacterium Micrococcus luteus, and spores of the entomopathogenic fungus Beauveria bassiana. Mosquitoes were injected at 20 h, and the expression of the Lp gene was monitored at 5, 12, and 24 h post-infection. In infected vitellogenic female mosquitoes, the Lp transcript expression level exhibited >2-fold increase at 5 h post-infection after injection of both Gram (+) bacteria and fungi when compared with those in control mosquitoes (Fig. 1A). The transcript levels remained significantly higher in infected mosquitoes at 12 and 24 h post-infection after either M. luteus or B. bassiana infections than in control mosquitoes (Fig. 1A). In contrast, infection with E. cloacae had no effect on the expression of the Lp gene (Fig. 1A).To investigate whether or not the Lp protein level was affected by the infection with bacteria and fungus, we performed a Western blot analysis with Lp antibodies (10Sun J. Hiraoka T. Dittmer N.T. Cho K.H. Raikhel A.S. Insect Biochem. Mol. Biol. 2000; 30: 1161-1171Crossref PubMed Scopus (67) Google Scholar). The experiments were performed similarly to those described above for the Lp transcript levels after infections with Gram (–) bacterium E. cloacae, Gram (+) bacterium M. luteus, and spores of the entomopathogenic fungus B. bassiana. In fat bodies of control mosquitoes, the Lp protein levels were decreased significantly by 44 h PBM (corresponding to 24 h post-infection). Injection of E. cloacae had no effect on the Lp protein profile. In contrast, infections with either M. luteus or B. bassiana spores resulted in sustained elevated levels of the Lp protein (Fig. 1B).Next, we investigated responses of the LpRfb, as a second gene involved in lipid metabolism. In infected previtellogenic female mosquitoes, the LpRfb transcript expression level was significantly increased by either M. luteus or B. bassiana infections but not by E. cloacae (Fig. 1C). The elevation of this gene in response to infection exhibited a maximal elevated response at expression 12 h post-infection (Fig. 1C). When infections were performed in blood-fed female mosquitoes, the LpRfb transcript responded similarly to that of previtellogenic mosquitoes, elevating its level 12 h post-infection in response to Gram (+) bacteria and fungi (Fig. 1D). In the control blood-fed female mosquito, LpRfb transcripts in the fat body reached their maximal levels as reported previously (14Cheon H.M. Seo S.J. Sun J. Sappington T.W. Raikhel A.S. Insect Biochem. Mol. Biol. 2001; 31: 753-760Crossref PubMed Scopus (78) Google Scholar, 15Seo S.J. Cheon. H.M. Sun J. Sappington T.W. Raikhel A.S. J. Biol. Chem. 2003; 278: 41954-41962Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar).Therefore, we observed a significant effect of infections on the expression of two essential genes of lipid metabolism, Lp and LpRfb. Importantly, expression of both these genes was elevated in the Aedes fat body in response to Gram (+) bacteria and fungal infections but not to Gram (–) bacteria. This type of immune regulation suggested involvement of the Toll/REL1 pathway in controlling expression of these two genes (38Shin S.W. Kokoza V. Bian G. Cheon H.M. Kim Y.J. Raikhel A.S. J. Biol. Chem. 2005; 280: 16499-16507Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar, 39Hoffmann J.A. Nature. 2003; 426: 33-38Crossref PubMed Scopus (1112) Google Scholar, 40Hultmark D. Curr. Opin. Immunol. 2003; 15: 12-19Crossref PubMed Scopus (468) Google Scholar).Effect of P. gallinaceum Infection on Lp and LpR Gene Expression— To investigate a possible effect of Plasmodium infection on the expression of Lp and LpR transcripts in A. aegypti, wild-type mosquitoes were fed on chicks infected with P. gallinaceum, and RNA samples were collected from fat bodies of infected mosquitoes throughout several stages of Plasmodium development. The level of Lp transcripts was significantly elevated in the fat body at 24 h after feeding on an infective blood meal, the stage when ookinetes invade the midgut (Fig. 2A). The expression levels of the LpRfb gene were also elevated in parasite-infected mosquitoes compared with those of uninfected mosquitoes but at a later stage (32 h PBM) (Fig. 2B). These experiments clearly showed that malaria infection caused the elevated expression of both Lp and LpRfb genes in the Aedes fat body.FIGURE 2The expression profiles of AaLp and AaLpRfb genes after P. gallinaceum infection. AaLp (A) and AaLpRfb (B) genes exhibited increased levels of expression after feeding in A. aegypti mosquitoes on the Plasmodium-infected blood. Real-time PCR was performed as described in Fig. 1. Data represent means ± S.E. of triplicate samples. Standard errors are shown.View Large Image Figure ViewerDownload Hi-res image Download (PPT)To examine the phenotypic effects on parasite development of silencing Lp and LpR genes, we prepared knock-out mosquitoes by injecting the females at 1–2 days post-eclosion with respective dsRNA. Mosquitoes with knockdown phenotype for Lp and LpR were infected with P. gallinaceum at 4 days after dsRNA injection. Infection levels were scored by the number of oocysts per midgut at 7 days post-infection (Fig. 3A). Controls showed that treatments with either anti-Lp or anti-LpR dsRNAi resulted in successful knockdown of both target genes (Fig. 3, B and C). Table 1 summarizes statistically evaluated results from three independent experiments. The Lp knockdown showed a marked and statistically significant effect (U test, p < 5–6, two-tailed): depletion of Lp resulted in a 12-fold decrease in parasite oocyst numbers (Fig. 3C and Table 1) and complete abolishment of egg development in ovaries of blood-fed mosquitoes (data not shown). In contrast, RNAi treatment of LpR had no significant effect on the parasite load compared with the control, iMal (U test, p = 0.32, two-tailed).FIGURE 3Effect of RNAi-mediated knockdown of AaLp and AaLpRfb on P. gallinaceum development in the mosquito midgut. A. aegypti female mosquitoes were injected with AaLp dsRNA (iLp), AaLpR dsRNA (iLpR), or with a control dsRNA derived from the noncoding region of a bacterial gene (iMal). Four days later, mosquitoes were infected with P. gallinaceum, and midguts were collected 7 days post-infection. A, AaLp knockdown (iLp) shows 12-fold reduction of oocyst numbers compared with control mosquitoes, whereas AaLpR knockdown (iLpR) shows no significant effect on parasite development. The data represent the pooled data set of three independent experiments. B and C, controls showing effect of AaLp dsRNA (iLp), AaLpR dsRNA (iLpR), and (iMal) on the levels of AaLp (B) and AaLpR (C) mRNA, which were determined by means of real-time PCR.View Large Image Figure ViewerDownload Hi-res image Download (PPT)TABLE 1Lipophorin influences vectorial capacity for P. gallinaceumdsRNANumber of experimentsTotal number of midgutsParasite loadRange of oocyst numbersU-testMal3559214-374p < 5-6Lp35590-44Mal3559214-374p = 0.32LpR353737-283 Open table in a new tab Toll/REL1 Pathway Regulation of Mosquito Lp and LpRfb Genes—Activation the Lp and LpRfb genes by Gram (+) bacteria, fungi, and Plasmodium, but not by Gram (–) bacteria, suggested that the Toll/REL1 pathway was involved in immune regulation of these genes (38Shin S.W. Kokoza V. Bian G. Cheon H.M. Kim Y.J. Raikhel A.S