Corrigendum to “A novel nanoluciferase transgenic reporter measures proteinuria in zebrafish.” Kidney Int. 2022;102:815–827

DOI of original article: https://doi.org/10.1016/j.kint.2022.05.019 The authors regret that the wrong sequence and concentration for the nphs2 morpholino were described in the original version of the manuscript. The sequence and concentration of the nphs2 morpholino have been corrected to TGCGATTTAAAACGTGTACCAGGGC and 1.0 mM, respectively, in the "Morpholino oligonucleotide treatments" portion of the Extended Supplementary Methods, where this information is described, and have been corrected in the article online. The data obtained with the morpholino (shown in Figure 3b of the main manuscript) are unchanged. The authors would like to apologize for any inconvenience caused. Download .pdf (5.01 MB) Help with pdf files Supplementary File (PDF) Figure S1. Comparison of luminescence in wild-type (WT) versus NLD3 adult tissue. Figure S2. Histology of adult liver in wild-type and NL-D3 transgenic zebrafish. Figure S3. Dextran uptake classification. Figure S4. NL-D3 proteinuria can be observed after a short incubation time. Figure S5. Standard curve data. Figure S6. Tracking of indels by decomposition (TIDE) analysis shows mutagenesis at gRNA site 1 in the Alport zebrafish crispants. Figure S7. Single allele analysis of col4a3 and col4a4 crispants. Figure S8. Nonannotated transmission electron microscopy (TEM) images of glomeruli in control and col4a3 and col4a4 crispants. Figure S9. Increasing 2,3-butanedione 2-monoxime (2,3-BDM) dose results in increasing effect on heart rate in zebrafish embryos. Extended Supplementary Methods. A novel nanoluciferase transgenic reporter measures proteinuria in zebrafishKidney InternationalVol. 102Issue 4PreviewThe zebrafish is an important animal system for modeling human diseases. This includes kidney dysfunction as the embryonic kidney (pronephros) shares considerable molecular and morphological homology with the human nephron. A key clinical indicator of kidney disease is proteinuria, but a high-throughput readout of proteinuria in the zebrafish is currently lacking. To remedy this, we used the Tol2 transposon system to generate a transgenic zebrafish line that uses the fabp10a liver-specific promoter to over-express a nanoluciferase molecule fused with the D3 domain of Receptor-Associated Protein (a type of molecular chaperone) which we term NL-D3. Full-Text PDF Open Access