Plant Seed Peroxygenase Is an Original Heme-oxygenase with an EF-hand Calcium Binding Motif

A growing body of evidence indicates that phytooxylipins play important roles in plant defense responses. However, many enzymes involved in the biosynthesis of these metabolites are still elusive. We have purified one of these enzymes, the peroxygenase (PX4450), from oat microsomes and lipid droplets. It is an integral membrane protein requiring detergent for its solubilization. Proteinase K digestion showed that PXG is probably deeply buried in lipid droplets or microsomes with only about 2 kDa at the C-terminal region accessible to proteolytic digestion. Sequencing of the N terminus of the purified protein showed that PXG had no sequence similarity with either a peroxidase or a cytochrome P450 but, rather, with caleosins, i.e. calcium-binding proteins. In agreement with this finding, we demonstrated that recombinant thale cress and rice caleosins, expressed in yeast, catalyze hydroperoxide-dependent mono-oxygenation reactions that are characteristic of PXG. Calcium was also found to be crucial for peroxygenase activity, whereas phosphorylation of the protein had no impact on catalysis. Site-directed mutagenesis studies revealed that PXG catalytic activity is dependent on two highly conserved histidines, the 9 GHz EPR spectrum being consistent with a high spin pentacoordinated ferric heme. A growing body of evidence indicates that phytooxylipins play important roles in plant defense responses. However, many enzymes involved in the biosynthesis of these metabolites are still elusive. We have purified one of these enzymes, the peroxygenase (PX4450), from oat microsomes and lipid droplets. It is an integral membrane protein requiring detergent for its solubilization. Proteinase K digestion showed that PXG is probably deeply buried in lipid droplets or microsomes with only about 2 kDa at the C-terminal region accessible to proteolytic digestion. Sequencing of the N terminus of the purified protein showed that PXG had no sequence similarity with either a peroxidase or a cytochrome P450 but, rather, with caleosins, i.e. calcium-binding proteins. In agreement with this finding, we demonstrated that recombinant thale cress and rice caleosins, expressed in yeast, catalyze hydroperoxide-dependent mono-oxygenation reactions that are characteristic of PXG. Calcium was also found to be crucial for peroxygenase activity, whereas phosphorylation of the protein had no impact on catalysis. Site-directed mutagenesis studies revealed that PXG catalytic activity is dependent on two highly conserved histidines, the 9 GHz EPR spectrum being consistent with a high spin pentacoordinated ferric heme. Plant peroxygenase (PXG) 3The abbreviations used are: PXG, peroxygenase; LD, lipid droplet; MOPS, 4-morpholinepropanesulfonic acid; HPLC, high performance liquid chromatography; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; ER, endoplasmic reticulum; 13-HPOD, 13-hydroperoxyoctadeca-9,11-dienoic acid; AIF-1, allographt inflammatory factor-1. is a versatile oxygenase that is strictly hydroperoxide-dependent for its activity. First discovered as an hydroxylase (1Ishimaru A. Yamazaki I. J. Biol. Chem. 1977; 252: 6118-6124Abstract Full Text PDF PubMed Google Scholar), it has been subsequently identified as a sulfoxidase (2Blée E. Durst F. Arch. Biochem. Biophys. 1987; 254: 43-52Crossref PubMed Scopus (33) Google Scholar) and an epoxidase (3Blée E. Schuber F. J. Biol. Chem. 1990; 265: 12887-12894Abstract Full Text PDF PubMed Google Scholar, 4Hamberg M. Hamberg G. Arch. Biochem. Biophys. 1990; 283: 409-416Crossref PubMed Scopus (74) Google Scholar). But detailed studies have revealed that only a single mechanism accounted for these different activities. In brief, peroxygenase catalyzes the direct transfer of one oxygen atom from a hydroperoxide, which is reduced into its corresponding alcohol to a substrate which will be oxidized (5Blée E. Wilcox A.L. Marnett L.J. Schuber F. J. Biol. Chem. 1993; 268: 1708-1715Abstract Full Text PDF PubMed Google Scholar). Accordingly, peroxygenase catalyzes hydroxylation reactions of aromatics, sulfoxidations of xenobiotics, or epoxidations of unsaturated fatty acids (Fig. 1). In mammals, most of these reactions are performed by cytochrome P450 monoxygenases. But it was shown that in contrast to such enzymes, PXG activity does not require any cofactor such as NAD(P)H and does not use molecular oxygen, excluding that PXG is encoded by a classical P450 monooxygenase (1Ishimaru A. Yamazaki I. J. Biol. Chem. 1977; 252: 6118-6124Abstract Full Text PDF PubMed Google Scholar, 3Blée E. Schuber F. J. Biol. Chem. 1990; 265: 12887-12894Abstract Full Text PDF PubMed Google Scholar). Presently, the function of PXG is not fully established. Associated with epoxide hydrolase, it composes "the peroxygenase pathway," which is involved in the oleic acid cascade leading to the synthesis of the C18 cutin monomers (6Blée E. Schuber F. Plant J. 1993; 4: 113-123Crossref Scopus (76) Google Scholar, 7Lequeu J. Fauconnier M.-L. Chammaï A. Bronner R. Blée E. Plant J. 2003; 36: 155-164Crossref PubMed Scopus (57) Google Scholar). However, PXG was also found to be very active in microsomes of plants such as soybean that possess cuticles poor in these C18 cutin precursors, therefore suggesting additional physiological role(s) for this enzyme (7Lequeu J. Fauconnier M.-L. Chammaï A. Bronner R. Blée E. Plant J. 2003; 36: 155-164Crossref PubMed Scopus (57) Google Scholar). Accordingly, it has been suggested that the peroxygenase pathway also leads to the formation of epoxy- and trihydroxy derivatives of linoleic acid (8Hamberg M. Hamberg G. Plant Physiol. 1996; 110: 807-815Crossref PubMed Scopus (70) Google Scholar, 9Blée E. Piazza G.J. Lipoxygenase and Lipoxygenase Pathway Enzymes. AOCS Press, Champaign, IL1996: 138-161Crossref Google Scholar), which are involved in defense responses against fungal infection in rice or tomato (10Ohta H. Shida K. Peng Y.-L. Furusawa I. Shishiyama J. Aibara S. Morita Y. Plant Cell Physiol. 1990; 31: 1117-1122Google Scholar, 11Kato T. Yamaguchi Y. Namai T. Hirukawa T. Biosci. Biotechnol. Biochem. 1993; 57: 283-287Crossref PubMed Scopus (43) Google Scholar, 12Namai T. Kato T. Yamaguchi Y. Hirukawa T. Biosci. Biotechnol. Biochem. 1993; 57: 611-613Crossref Scopus (43) Google Scholar). The peroxygenase pathway also constitutes one branch of the so-called "lipoxygenase pathway," where, as the first step, lipoxygenase catalyzes oxygenation of unsaturated fatty acids (C18:2, C18:3, or C16:3), yielding the corresponding fatty acids hydroperoxides. These very reactive compounds are then transformed to a series of oxylipins involved in plant defense by several enzymes, among which allene oxide synthase and fatty acid hydroperoxide lyase have been best characterized (13Blée E. Trends Plant Sci. 2002; 7: 315-321Abstract Full Text Full Text PDF PubMed Scopus (478) Google Scholar). The cloning of genes encoding some of these hydroperoxide-transforming enzymes has revealed that they so far all belong to a new family of unusual cytochromes P450s referred to as CYP74. They differ from the classical P450s by their exclusive reaction with fatty acid hydroperoxides instead of using molecular oxygen and reductants. To date, research in the oxylipins field has largely focused on two specific branches of the lipoxygenase pathway, namely those involving CYP74A (allene oxide synthase) and CYP74B (hydroperoxide lyase), which result in the production of jasmonates and volatile aldehydes, respectively. In contrast, little is known at the molecular level on the enzymes involved in the other branches of the lipoxygenase pathway. Although the molecular mechanism of the peroxygenase is now better defined, the gene encoding this protein and the nature of the gene product are still unknown. Thus, one primary goal of the present investigation was to identify the PXG gene and to compare the encoded protein with other oxygenases such as cytochromes P450 and peroxidases. Although PXG activities have been detected in a wide variety of plants, previous efforts to purify this enzyme to homogeneity or to clone its encoding gene were unsuccessful. PXG shares some features with CYP74s, i.e. they are both membrane-bound hemoproteins that accept fatty acid hydroperoxides as substrates. Therefore, we have first assumed that PXG was a new member of the CYP74 family. But all of our attempts to clone the gene encoding the peroxygenase by sequence similarity with CYP74 members failed. Therefore, we purified the peroxygenase from oat seeds, sequenced the N terminus, identified Arabidopsis homologues by data base screening, expressed the corresponding genes in yeast, and demonstrated that PXG was a distinct and atypical oxygenase. In contrast to all other oxygenases involved in the oxylipin pathway, it belongs to a small family of proteins, known as "caleosins" (14Chen E.C. Tai S.S. Peng C.C. Tzen J.T. Plant Cell Physiol. 1998; 39: 935-941Crossref PubMed Scopus (64) Google Scholar). These proteins contain a Ca2+ binding motif and several phosphorylation sites that could be important for activity and regulation of PXG. This enzyme was present in the endoplasmic reticulum but also in lipid bodies that we will here refer to as lipid droplets (LDs) in accordance with a recently suggested nomenclature (15Martin S. Parton R.G. Nat. Rev. Mol. Cell Biol. 2006; 7: 373-378Crossref PubMed Scopus (929) Google Scholar). They are small vesicles composed of a core of lipids surrounded by a half-unit membrane of phospholipids and some proteins embedded therein (16Murphy D.J. Vence J. Trends Biochem. Sci. 1999; 24: 109-115Abstract Full Text Full Text PDF PubMed Scopus (482) Google Scholar). The apparent dual localization of PXG raised the question of the mode of integration of intrinsic membrane proteins into bi- or monolayer phospholipid structures. Importantly, the identification of PXG as a caleosin also opens new perspectives for possible physiological roles of this type of proteins, which had no function identified to date. Materials—Commonly used chemicals and reagents were of the highest purity available. Purified oligonucleotides were provided either by Invitrogen, Eurogentec, or by Sigma Genosys. [1-14C]Oleic acid (52 Ci/mol) and [1-14C]linoleic acid (55 Ci/mol) were purchased from PerkinElmer Life Sciences. Rice seeds (Oryza sativa, var. indica, cv. IR64) soaked for 2 h in water were germinated on two layers of cloth saturated with water under a photoperiod of 16 h. Plants were harvested 7 days later, frozen in liquid nitrogen, and kept at –80 °C until use. Preparation of Oat Subcellular Fractions—Isolation of microsomal fraction from oat seeds soaked overnight in water was performed essentially as described previously for soybean seedlings (3Blée E. Schuber F. J. Biol. Chem. 1990; 265: 12887-12894Abstract Full Text PDF PubMed Google Scholar). During this procedure (after the second centrifugation step at 100,000 × g) a floating layer consisting of lipid droplets was collected from the top of the tubes with a pipette. The crude lipid droplet fraction was carefully washed with 100 mm potassium pyrophosphate buffer that contained 0.1 m sucrose (pH 7.4). After centrifugation at 100,000 × g for 45 min, the lipid droplet fraction was then resuspended in 10 mm potassium phosphate buffer containing 0.1 m sucrose (pH 7.4) and centrifuged at 100,000 × g for 45 min. LDs were finally resuspended in 10 mm Tris-HCl buffer containing 10% glycerol (pH 8). Purification of Oat Peroxygenase—All the subsequent steps were performed at 4 °C. Washed microsomes or LDs (30 mg protein) resuspended in 5 ml of a 10 mm Tris-HCl buffer (pH 8) containing 10% glycerol (buffer A) were treated with emulphogene (polyoxyethylene 10 tridecyl ether from Sigma, final concentration 0.2% v/v) for 45 min. The mixture was then centrifuged at 100,000 × g for 45 min. The supernatant was applied to a 1 × 2-cm column of DEAE-Trisacryl M (BioSepra) equilibrated with buffer B (buffer A containing 0.2% emulphogene (v/v)). After the column was washed with buffer B to eliminate the first protein peak, peroxygenase activity was eluted with a linear NaCl gradient (0→ 1 m) in buffer B (2 × 30 ml). The flow rate was 0.5 ml/min, and 5 ml fractions were collected. The fractions containing the peak of peroxygenase were pooled and dialyzed overnight against 2 × 2 liters of 10 mm sodium acetate (pH 5.5) containing 10% glycerol and 0.2% (v/v) emulphogene (buffer C). The dialyzed fraction was applied on a 1 × 10-cm column of CM-Sepharose CL-6B (GE Healthcare) equilibrated with buffer C. After the column was washed with buffer C, peroxygenase activity was eluted with a linear NaCl gradient (0 → 1 m) in buffer C (2 × 30 ml). The flow rate was 0.5 ml/min, and 5 ml fractions were collected. This purification protocol was repeated three times to isolate sufficient amounts of protein. The fractions containing the peak of peroxygenase activity were pooled and dialyzed overnight against buffer C and applied on a column of CM-Sepharose CL-6B. Peroxygenase activity was eluted as described above. The total amount of proteins was measured after each purification step by the Bradford assay (Bio-Rad) using bovine serum albumin as a standard. Subcloning of AtPXG1, AtPXG2, and OsPXG—Full-length AtPXG1 (At4g26740) and AtPXG2 (At5g55240) were amplified from an Arabidopsis cDNA library by PCR using primers AtPXG1F and AtPXG1R and primers AtPXG2F and AtPXG2R, respectively (Table 1). To facilitated cloning, BamHI or XbaI restriction sites were attached to the primers. For the further purification of AtPXG1, PCR was performed using primers AtPXG1NHis and AtPXG1CHis to add a His tag at either the N- or C-terminal ends of the PXG gene. We used also PCR for adding the FLAG epitope at the C terminus of AtPXG1. The amplified products were first cloned into the pCR®2.1-TOPO vector (TOPO TA cloning® kit, Invitrogen) and, after sequencing, subcloned into the yeast constitutive expression vector pVT102U (17Verner T. Dignar D. Thomas D.Y. Gene (Amst.). 1987; 52: 225-233Crossref PubMed Scopus (465) Google Scholar) using the BamHI/XbaI site.TABLE 1Summary of primersNameSequence (5′ to 3′)AtPXG1FCGGGATCCATGGGGTCAAAGACGGAGATAtPXG1RGCTCTAAGATTAGTAGTGCTGTCTTGTCAtPXG2FCGGGATCCATGACGTCGATGGAGAGGATGAtPXG2RCGGGATCCATGGCAGGAGAGGCAGAGGCAtPXG1NHGGGATCCATGCACCACCACCACCACCACATGGG GTCAAAGACGGAGATAtPXG1CHGCTCTAGATTAGTGGTGGTGGTGGTGGTGGTAG TATGCTGTCTTGTCAtPXG1NFGCGGATCCATGGGGTCAAAGACGGAGAtPXG1CFGCTCTAGATTATTTATCATCATCATCTTTATAA TCGTAGTATGCTGTCTTGTCOsPXGFCGGGATCCATGGCGGAGGAGGCGGCTAGCOsPXGRGCTCTAGACCTACTTCTGCTTCTCATGTGCT15VFGGAGAGAGACGCAATGGCTGTTGTGGCTCCCTATGCGCCGH52VGCAAGCACCAGACAGAGAAGTTCCGTACGGAACTCCAGGCH59VCGGAACTCCAGGCGTTAAGAATTACGGH70VCTTAGTGTTCTTCAACAGGTTGTCTCCTTCTTCGATATCGT116VFCCTGACCCTTAGCTATGCCGTTCTTCCGGGGTGGTTACCH131VCCTTTCTTCCCTATATACATAGTTAACATACACAAGTCAA AGCH134VCCCTATATATACATACACAACATAGTTAAGTCAAAGCA TGGH138VCACAAGTCAAAGGTTGGAAGTGATTCK196VFGGATGGATCGCAGGCGTAATAGAGTGGGGACTGC221GGCTATTAGGCGGGGTTTCGATGGAAGCC230GGCTTGTTCGAGTACGGTGCCAAAATCTACGC Open table in a new tab mRNAs were isolated from rice seedlings (0.5g) with the QuickPrep Micro mRNA purification kit(GE Healthcare). First strand cDNA was synthesized by incubation of mRNA (3 μg) with 5 units of Moloney murine leukemia virus reverse transcriptase (Promega) and oligo(dT)24 at 37°C for 2 h in a 50-μl reaction volume. The cDNA (5 μl) was subsequently amplified by PCR in a 50-μl reaction volume using 25 μl of HIFI PCR Master (Roche Applied Science) and 400 nm gene-specific primers OsPXGF and OsPXGR. The amplicon was subcloned as described above. Expression and Purification of Recombinant PXGs—The addition of His or FLAG tags either at the N or C terminus did not modify the catalytic activity of the resulting enzyme. Therefore, we used recombinant enzymes with tags added to their C terminus. His-tagged or Flag-tagged AtPXG1, AtPXG2, and OsPXG were expressed in Saccharomyces cerevisiae Wa6 (ade, his7-2 leu2-3 leu2-112 ura3-52) (18Schiestl R.H. Gietz R.D. Curr. Genet. 1989; 16: 339-346Crossref PubMed Scopus (1776) Google Scholar). Expression of the recombinant PXGs in transformed yeast cells was carried out as follows. 6 ml of S medium (7 g/liter yeast nitrogen base, 1 g/liter casamino acids, 20 g/liter glucose supplemented with 50 μg/ml histidine, 200 μg/ml adenine, and 50 μg/ml leucine) was inoculated with recombinant yeast and grown for 2 days with shaking at 30 °C. Then 1-ml portions were used to inoculate six 250-ml cultures of S medium. After 2 days, the resulting cultures were pelleted by centrifugation at 5000 × g, and the cells were washed with 200 ml of buffer D (50 mm Tris-HCl (pH 7.5)). The pellet was resuspended in 100 ml of buffer D containing 0.6 m sorbitol, and the yeast cells were disrupted with glass beads. The resulting lysate was centrifuged once at 10,000 × g for 15 min. The supernatant was recovered and centrifuged at 100,000 × g for 90 min. The pellet was finally resuspended in 10 mm potassium phosphate (pH 8) containing 10% glycerol (v/v) and treated with emulphogene (final concentration, 0.2%) for 45 min at 4 °C. The mixture was centrifuged at 100,000 × g for 2 h. His-tagged PXG or FLAG-tagged PXGs present in the supernatant were purified on a nickel-nitrilotriacetic acid Superflow column (Qiagen) or on a FLAG affinity gel (Sigma), respectively, using procedures recommended by the manufacturer. Such purifications were carried out at 4 °C in the presence of 10% glycerol and 0.2% emulphogene (v/v). The purity of the samples was confirmed by SDS-PAGE followed by silver staining. Enzymatic Activities—Peroxygenase activity was routinely measured (e.g. during the purification procedure) with aniline as substrate (2Blée E. Durst F. Arch. Biochem. Biophys. 1987; 254: 43-52Crossref PubMed Scopus (33) Google Scholar). Sulfoxidase activity was assayed by using either methyl p-tolyl sulfoxide or thiobenzamide as substrates, as previously described (19Blée E. Durst F. Biochem. Biophys. Res. Commun. 1986; 135: 922-927Crossref PubMed Scopus (9) Google Scholar, 20Blée E. Schuber F. Biochemistry. 1989; 28: 4962-4967Crossref Scopus (46) Google Scholar). Epoxidation of [1-14C]oleic and linoleic acids was performed according to Blée and Schuber (3Blée E. Schuber F. J. Biol. Chem. 1990; 265: 12887-12894Abstract Full Text PDF PubMed Google Scholar). The metabolism of 13-hydroperoxy-[1-14C]octadecadienoic acid was studied as described before (5Blée E. Wilcox A.L. Marnett L.J. Schuber F. J. Biol. Chem. 1993; 268: 1708-1715Abstract Full Text PDF PubMed Google Scholar). Site-directed Mutagenesis—Site-directed mutagenesis was performed using the QuikChange™ site-directed mutagenesis kit of Stratagene with the sense mutations primers described in the PCR primers sections (modified codons are underlined, and the nucleotide changes are indicated in bold in Table 1). Heme Content Determination—The heme staining procedure was carried according to Noordermeer et al. (21Noordermeer M.A. van Dijken A.J.H. Smeekens S.C.M. Veldink G.A. Vliegenthart F.G. Eur. J. Biochem. 2000; 267: 2473-2482Crossref PubMed Scopus (67) Google Scholar). Hemin (from Sigma) was used as standard for the quantification of heme at 370 nm. Oat Antibodies and Western Blot Analysis—The production of rabbit polyclonal antibodies was performed using standard immunization protocols. Proteins were fractionated by 15% SDS-PAGE and electrotransferred to Immobilon-P membranes (Millipore Corp., Bedford, MA) using a mini-transblot transfer cell apparatus (Bio-Rad). High precision Protein™ Standards (Bio-Rad) were used as molecular weight markers. For detection of AtPXG:His, a mouse monoclonal anti-His antibody and an anti-mouse antibody conjugated to peroxidase were used at 1:500 and 1:5000 dilutions, respectively. Blots were developed using the ECL kit from Pierce. N-terminal Sequencing of PXGs—After separation by SDS-PAGE using a 12.5% polyacrylamide gel, the proteins were transferred to a polyvinylidene difluoride membrane. Edman degradation was performed with an automated sequenator (Applied Biosystems 492 Procise). Proteolysis—Microsomes were washed in 50 mm Tris/HCl buffer (pH 8) containing 10 mm CaCl2 and resuspended in an equal volume of this buffer. Aliquots of microsomes (100 μl containing 1.5 mg proteins) were incubated with increased quantities of proteinase K (from 15 to 750 μg) in a total volume of 175 μl at 37 °C overnight. Aliquots of 50 μl were removed for immediate measure of PXG residual activity. The proteinase was then inhibited by the addition of 1 mm phenylmethylsulfonyl fluoride. A similar protocol was used for proteinase K treatment of LDs. Phosphorylation Experiments—Proteinase-treated microsomes were incubated in the presence of 0.1 unit of casein kinase II and 4 μCi of [γ-35S]ATP in 100 mm KH2PO4 buffer (pH 7.5) containing 8 mm MgCl2 for 4 h at 27 °C. Proteins and peptides separated by SDS/PAGE were transferred to a polyvinylidene difluoride membrane for immuno- and radio-detections. Similar protocol was used for the phosphorylation of purified AtPXG1 except that this fraction was incubated for 1 h at 4°C to preserve enzymatic activity. Synthesis of Radiolabeled Substrates—Racemic 9,10-[1-14C]epoxystearic acid (1.9 GBq/mmol) and 13(S)-[1-14C]hydroperoxyoctadeca-9(Z),11(E)-dienoic acid were synthesized as previously described (3Blée E. Schuber F. J. Biol. Chem. 1990; 265: 12887-12894Abstract Full Text PDF PubMed Google Scholar). Electron Paramagnetic Resonance (EPR) Spectroscopy—Conventional 9-GHz EPR measurements were performed using a Bruker ER 300 spectrometer with a standard TE102 cavity equipped with a liquid helium cryostat (Oxford Instrument) and a microwave frequency counter (Hewlett Packard 5350B). The spectra of frozen samples of oat peroxygenase (0.1 mm concentration, 50 mm acetate buffer, pH 5.0) and horseradish peroxidase (0.5 mm concentration, 100 mm MOPS buffer, pH 7.0) were recorded at 4 K. Analytical Procedures—Radioactivity was measured on TLC plates with a Berthold TLC linear detector LB 2821, and peak integration was obtained by using the program CHROMA 1D (Packard Instrument Co.). Radioactivity was also determined in a liquid scintillation spectrometer (LS 9000, Beckman). Chiralphase HPLC was performed under isocratic conditions on a Shimadzu instrument coupled with a radiomatic 500TR analyzer (Packard Instrument Co.). Peak integration was obtained using Flo-one software. The resolution of the enantiomers of 14C-labeled methyl cis-9,10-epoxystearate was performed on a Chiralcel OB column (4.6 × 250 mm; Baker Chemical Co.) with a solvent mixture of n-hexane/isopropanol (98.5:1.5 at 0.3 ml/min). The separation of the R and S enantiomers of methyl p-toluyl sulfoxide was achieved on the same chiral column eluted with a solvent mixture of n-hexane-isopropanol (80:20 at 0.6 ml/min). Products obtained after the reaction of 13-hydroperoxy-octadeca-9,11-dienoic acid (13-[1-14C]HPOD) with recombinant AtPXG1 were separated by reverse phase (RP)-HPLC on a Lichrospher (Agilent Technologies) 100 RP-18 (5-μm) column with a solvent mixture of acetonitrile:water:acetic acid (50:50: 0.1, v/v/v) at 0.6 ml/min. Identification of the trihydroxy derivative of linoleic acid was achieved by gas chromatography-mass spectroscopy analysis after methylation of the acid function with ethereal diazomethane and silylation of the hydroxyl groups with N-methyl-N-trimethylsilyl-trifluoroacetamine (Pierce). Gas chromatography-mass spectroscopy analysis was performed on an Agilent 5973 N apparatus with ionizing energy of 70 eV. The sample was injected directly into a DB-5-coated fused capillary column (30 m; 0.25-mm internal diameter; J. W. Scientific) with a temperature program of 10 °C/min from 100 to 280 °C followed by 10 min at 280 °C. Purification of PXG from Oat Seed Microsomes—Peroxygenase activity was purified from oat seeds and was found to be localized to microsomal fractions. The membrane-bound peroxygenase could not be released by treatment with 3 m KCl, confirming that the enzyme is an integral membrane protein (19Blée E. Durst F. Biochem. Biophys. Res. Commun. 1986; 135: 922-927Crossref PubMed Scopus (9) Google Scholar). We, therefore, tested various detergents (CHAPS, BIG-CHAP, octylglucoside, Triton X-100, emulphogene) for their ability to solubilize the enzyme. Emulphogene (0.2%) was among the most effective. The solubilized membrane extract was purified according to the protocol described under "Experimental Procedures." The instability of the peroxygenase caused severe problems especially during dialysis and concentration of the pooled fractions, but the addition of glycerol (10%) contributed to some extent to stabilize PXG (Table 2). Further purification using strong cationic exchanger (Mono S) or hydrophobic column (alkyl-Superose) resulted in a loss of enzyme activity. It is unclear whether this loss of activity is the result of inactivation or irreversible binding of the enzyme to the columns. Analysis on SDS-PAGE of the final fractions containing PXG activity showed a bulk of proteins of low molecular weight near the migration front but also a band around 27 kDa, whose intensity was correlated with peroxygenase activity (Fig. 2). The N terminus sequence of this protein (AVVVSDAMSSVAKGAPVTAQ) exhibited similarity with ATS1 (39% identity), encoding an embryo-specific gene in Arabidopsis (22Nuccio M.L. Thomas T.L. Plant Mol. Biol. 1999; 39: 1153-1163Crossref PubMed Scopus (43) Google Scholar) and with abscisic acid-induced EFA 27 in rice (35%), a membrane-bound protein having a mass of 27 kDa (23Frandsen G.I. Müller-Uri F. Nielsen M. Mundy J. Skriver K. J. Biol. Chem. 1996; 271: 343-348Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). These proteins belong to a small family called caleosin (24Chen J.C.F. Tsai C.C.Y. Tzen J.T.C. Plant Cell Physiol. 1999; 40: 1079-1086Crossref PubMed Scopus (162) Google Scholar) because they contain a calcium binding domain and seem to possess similar structural features with oleosins, which are found in lipid droplets. This apparent localization of caleosin prompted us to examine if lipid droplets display PXG activity.TABLE 2Representative purification of membrane-bound peroxygenase from oat seedlingsPurification stageTotal activitySpecific activityPurification factornmol/min%nmol/min/mgMicrosomes46410015.41Solubilization29162.763.74.2DEAE-Trisacryl30064.7150.19.8Dialysis27358.8147.99.6CM-Sepharose25655.1365.524.7 Open table in a new tab Purification of PXG from Oat Seed Lipid Droplets—Purified lipid droplets isolated from oat seeds were able to perform co-oxidation reactions known to be catalyzed by peroxygenases. For example, they actively oxidized thiobenzamide to its sulfoxide (65.8 nmol/min/mg of protein) and oleic acid into 9,10-epoxy-stearate (51.4 nmol/min/mg of protein). It should be noted that these activities were about four times higher than those determined in microsomal fractions. Consequently, we performed the purification of PXG from lipid droplets following the same protocol used for the microsomal fraction. Detergent was required to solubilize the peroxygenase activity from lipid droplets, suggesting that the protein was buried into the phospholipids monolayer or lipid core of these organelles. Silver nitrate staining of the purified enzyme fraction separated by SDS-PAGE showed two major bands at about 40 and 27 kDa. But only the intensity of the latter was correlated with the activity of the peroxygenase. The N terminus sequence of this 27-kDa protein (AVVVSDAMSSVAKGAPVTAQRPVXXD) was identical to that of the protein isolated from oat seeds microsomes (but extended the sequence by some amino acids) and, thus, also showed homologies with caleosins (48 and 43% with ATS1 and EF27, respectively). Considering that most of caleosins identified so far have a molecular mass around 25–29 kDa, we hypothesized that the purified 27-kDa protein might be a caleosin supporting peroxygenase activity. Expression of Caleosins in Yeast and Identification as Plant Peroxygenases—To validate that PXG was indeed a caleosin, we have expressed in yeast the first caleosin identified in Arabidopsis (At4g26740, also named ATS1 or AtClo1 (22Nuccio M.L. Thomas T.L. Plant Mol. Biol. 1999; 39: 1153-1163Crossref PubMed Scopus (43) Google Scholar, 25Naested H. Frandsen G.I. Jauh G.-Y. Hernadez-Pinzon I. Nielsen H.B. Murphy D.J. Rogers J.C. Mundy J. Plant Mol. Biol. 2000; 44: 463-476Crossref PubMed Scopus (151) Google Scholar)). Crude extracts of yeast expressing the recombinant protein catalyzed co-oxidation reactions typical of peroxygenase such as sulfoxidation of thiobenzamide (5.8 nmol/min/mg of protein), hydroxylation of aniline (4.5 nmol/min/mg of protein), or epoxidation of oleic acid (1.5 nmol/min/mg of protein). Importantly, all these activities were strictly hydroperoxide-dependent. Yeast crude extracts were then subfractionated by differential centrifugations into 100,000 × g supernatant, microsomes, and lipid droplets. Whereas microsomes and lipid droplets actively catalyzed co-oxidation reactions (for example, 62 and 124 nmol/min/mg of protein of thiobenzamide sulfoxide formed, respectively), the soluble fraction was found inactive. Neither extract from wild type WA6 nor yeast transformed with an empty vector showed any catalytic activity. Based on these experiments we annotate At4g26740 encoding peroxygenase as AtPXG1. To evaluate if such oxidative capacities of AtPXG1 are common to other caleosins, we have studied two other members of this family of proteins; Atclo2, recently renamed ATS2, which is believed to be associated with dormancy or germination of Arabidopsis seeds (26Toorop P.E. Barroco R.M. Engler G. Groot S.P.C. Hilhorst H.W.M. Planta. 2005; 221: 6