Modulation of AUUUA Response Element Binding by Heterogeneous Nuclear Ribonucleoprotein A1 in Human T Lymphocytes

The heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) shuttles between the cytoplasm and nucleus and plays important roles in RNA metabolism. Whereas nuclear hnRNP A1 has been shown to bind intronic sequences and modulate splicing, cytoplasmic hnRNP A1 is associated with poly(A)+ RNA, indicating different RNA ligand specificity. Previous studies indicated that cytoplasmic hnRNP A1 is capable of high-affinity binding of reiterated AUUUA sequences (ARE) that have been shown to modulate mRNA turnover and translation. Through a combination of two-dimensional gel and proteolysis studies, we establish hnRNP A1 (or structurally related proteins that are post-translationally regulated in an identical manner) as the dominant cytoplasmic protein in human T lymphocytes capable of interacting with the ARE contained within the context of full-length granulocyte-macrophage colony-stimulating factor mRNA. We additionally demonstrate that cytoplasmic hnRNP A1 preferentially binds ARE relative to pre-mRNAs in both cross-linking and mobility shift experiments. RNA polymerase II inhibition increased the binding of ARE (AUBP activity) and poly(U)-Sepharose by cytoplasmic hnRNP A1, while nuclear hnRNP A1 binding was unaffected. Nuclear and cytoplasmic hnRNP A1 could be distinguished by the differential sensitivity of their RNA binding to diamide and N-ethylmaleimide. The increase in AUBP activity of cytoplasmic hnRNP A1 following RNA polymerase II inhibition correlated with serine-threonine dephosphorylation, as determined by inhibitor and metabolic labeling studies. Thus, cytoplasmic and nuclear hnRNP A1 exhibit different RNA binding profiles, perhaps transduced through serine-threonine phosphorylation. These findings are relevant to the specific ability of hnRNP A1 to serve distinct roles in post-transcriptional regulation of gene expression in both the nucleus and cytoplasm. The heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) shuttles between the cytoplasm and nucleus and plays important roles in RNA metabolism. Whereas nuclear hnRNP A1 has been shown to bind intronic sequences and modulate splicing, cytoplasmic hnRNP A1 is associated with poly(A)+ RNA, indicating different RNA ligand specificity. Previous studies indicated that cytoplasmic hnRNP A1 is capable of high-affinity binding of reiterated AUUUA sequences (ARE) that have been shown to modulate mRNA turnover and translation. Through a combination of two-dimensional gel and proteolysis studies, we establish hnRNP A1 (or structurally related proteins that are post-translationally regulated in an identical manner) as the dominant cytoplasmic protein in human T lymphocytes capable of interacting with the ARE contained within the context of full-length granulocyte-macrophage colony-stimulating factor mRNA. We additionally demonstrate that cytoplasmic hnRNP A1 preferentially binds ARE relative to pre-mRNAs in both cross-linking and mobility shift experiments. RNA polymerase II inhibition increased the binding of ARE (AUBP activity) and poly(U)-Sepharose by cytoplasmic hnRNP A1, while nuclear hnRNP A1 binding was unaffected. Nuclear and cytoplasmic hnRNP A1 could be distinguished by the differential sensitivity of their RNA binding to diamide and N-ethylmaleimide. The increase in AUBP activity of cytoplasmic hnRNP A1 following RNA polymerase II inhibition correlated with serine-threonine dephosphorylation, as determined by inhibitor and metabolic labeling studies. Thus, cytoplasmic and nuclear hnRNP A1 exhibit different RNA binding profiles, perhaps transduced through serine-threonine phosphorylation. These findings are relevant to the specific ability of hnRNP A1 to serve distinct roles in post-transcriptional regulation of gene expression in both the nucleus and cytoplasm. The heterogeneous nuclear ribonucleoproteins (hnRNP) 1The abbreviations used are: hnRNP, heterogeneous nuclear ribonucleoprotein; ARE, AUUUA sequences; AUBP, AU-rich binding proteins; GM-CSF, granulocyte-macrophage colony-stimulating factor; PIPES, 1,4-piperazinediethanesulfonic acid; PHA, phytohemagglutinin; PAGE, polyacrylamide gel electrophoresis; CAPS, 3-(cyclohexylamino)propanesulfonic acid; 2-D NEPHGE, two-dimensional nonequilibrium pH-gradient electrophoresis. were originally defined as the proteins constituting the 40 S complexes isolated from nuclei following nuclease treatment (reviewed in Refs. 1Dreyfuss G. Annu. Rev. Cell Biol. 1986; 2: 459-498Crossref PubMed Scopus (209) Google Scholar and 2Dreyfuss G. Matunis M.J. Pinol-Roma S. Burd C.G. Annu. Rev. Cell Biol. 1993; 62: 289-321Google Scholar). The hnRNP proteins range in mass from 30 to 120 kDa and associate with pre-mRNA as a complex (1Dreyfuss G. Annu. Rev. Cell Biol. 1986; 2: 459-498Crossref PubMed Scopus (209) Google Scholar, 2Dreyfuss G. Matunis M.J. Pinol-Roma S. Burd C.G. Annu. Rev. Cell Biol. 1993; 62: 289-321Google Scholar). Studies of hnRNP-RNA interactions have demonstrated sequence-specific binding, both in vitroand in vivo (3Amero S.A. Matunis M.J. Matunis E.L. Hockensmith J.W. Raychaudhuri G. Beyer A.L. Mol. Cell. Biol. 1993; 13: 5323-5330Crossref PubMed Scopus (22) Google Scholar, 4Matunis E.L. Matunis M.J. Dreyfuss G. J. Cell Biol. 1993; 121: 219-228Crossref PubMed Scopus (97) Google Scholar, 5Swanson M.S. Dreyfuss B. Mol Cell. Biol. 1988; 8: 2237-2241Crossref PubMed Scopus (251) Google Scholar), as well as roles in pre-mRNA splicing and splice-site selection (2Dreyfuss G. Matunis M.J. Pinol-Roma S. Burd C.G. Annu. Rev. Cell Biol. 1993; 62: 289-321Google Scholar, 6Choi Y.D. Grabowski P.J. Sharp P.A. Dreyfuss G. Science. 1986; 231: 1534-1539Crossref PubMed Scopus (252) Google Scholar, 7Swanson M.S. Dreyfuss G. EMBO J. 1988; 7: 3519-3529Crossref PubMed Scopus (176) Google Scholar). Consistent with this latter observation, native hnRNP A1 and C proteins have been reported to bind a polypyrimidine stretch bordered by AG at the 3′ end of introns (7Swanson M.S. Dreyfuss G. EMBO J. 1988; 7: 3519-3529Crossref PubMed Scopus (176) Google Scholar, 8Mayrand S.H. Pederson T. Nucleic Acids Res. 1990; 18: 3307-3318Crossref PubMed Scopus (38) Google Scholar). Similar findings have been made with recombinant hnRNP A1 (9Burd C.G. Dreyfuss G. EMBO J. 1994; 13: 1197-1204Crossref PubMed Scopus (430) Google Scholar, 10Buvoli M. Cobianchi F. Biamonti G. Riva S. Nucleic Acids Res. 1990; 18 (6000): 6595Crossref PubMed Scopus (54) Google Scholar), which demonstrated equivalent binding to 5′- and 3′-intronic splice sites (9Burd C.G. Dreyfuss G. EMBO J. 1994; 13: 1197-1204Crossref PubMed Scopus (430) Google Scholar). These findings are of functional interest because hnRNP A1 has been shown to modulate the effects of splicing factor 2 (SF2/ASF), and promote distal 5′-splice site selection (8Mayrand S.H. Pederson T. Nucleic Acids Res. 1990; 18: 3307-3318Crossref PubMed Scopus (38) Google Scholar,11Caceres J. Stamm S. Helfman D.M. Krainer A.R. Science. 1994; 265: 1706-1710Crossref PubMed Scopus (564) Google Scholar, 12Mayeda A. Helfman D.M. Krainer A.R. Mol. Cell. Biol. 1993; : 2993-3001Crossref PubMed Scopus (202) Google Scholar, 13Yang X. Bani M.R. Lu S.J. Rowan S. Ben-David Y. Chabot B. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 6924-6928Crossref PubMed Scopus (181) Google Scholar). The role of hnRNP A1 in mRNA metabolism expanded with demonstration that hnRNP A1 shuttles between the nucleus and the cytoplasm (14Pinol-Roma S. Dreyfuss G. Nature. 1992; 355: 730-732Crossref PubMed Scopus (742) Google Scholar). With inhibition of RNA polymerase II transcription, hnRNP A1 rapidly accumulates in the cytoplasm in association with poly(A)+RNA (14Pinol-Roma S. Dreyfuss G. Nature. 1992; 355: 730-732Crossref PubMed Scopus (742) Google Scholar), indicating that cytoplasmic hnRNP A1 recognizes and binds non-intronic mRNA sequences under these conditions. These findings suggest that hnRNP A1 exhibits different RNA binding specificity in the cytoplasm relative to the nucleus, perhaps enabling distinct functional roles pertinent to RNA metabolism in each subcellular compartment, in a manner not dissimilar to other proteins involved in RNA metabolism that exhibit dual functions (15Klausner R.D. Rouault T.A. Harford J.B. Cell. 1993; 72: 19-28Abstract Full Text PDF PubMed Scopus (1055) Google Scholar, 16Muller E.W. Kuhn L.C. Cell. 1988; 53: 815-825Abstract Full Text PDF PubMed Scopus (375) Google Scholar, 17Nagy E. Rigby W.F.C. J. Biol. Chem. 1995; 270: 2755-2763Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar). In previous work, our laboratory demonstrated five cytoplasmic proteins in activated human T lymphocytes which are capable of binding the highly conserved AU-rich elements (ARE) in oligoribonucleotide probes representative of the 3′-untranslated region of lymphokines and proto-oncogenes (18Hamilton B.J. Nagy E. Malter J.S. Arrick B.A. Rigby W.F.C. J. Biol. Chem. 1993; 268: 8881-8887Abstract Full Text PDF PubMed Google Scholar). Consisting of reiterations of the pentanucleotide AUUUA or oligo(U)4–7 sequences in an AU-rich context, ARE are capable of modulating mRNA turnover and translation in heterologous constructs (Refs. 19Greenberg M.E. Belasco J.G. Belasco J.G. Brawerman G. Control of Messenger RNA Stability. Academic Press, New York1993: 199-218Crossref Google Scholar, 20Han J. Brown T. Beutler B. J. Exp. Med. 1990; 171: 465-475Crossref PubMed Scopus (431) Google Scholar, 21Jones T.R. Cole M.D. Mol. Cell. Biol. 1987; 7: 4513-4521Crossref PubMed Scopus (213) Google Scholar, 22Elzinga S.D.J. Bednarz A.L. van Oosterum K. Dekker P.J.T. Grivell L.A. Nucleic Acids Res. 1993; 21: 5328-5331Crossref PubMed Scopus (66) Google Scholar, 23Schuler G.D. Cole M.D. Cell. 1988; 55: 1115-1122Abstract Full Text PDF PubMed Scopus (155) Google Scholar, 24Shaw G. Kamen R. Cell. 1986; 46: 659-669Abstract Full Text PDF PubMed Scopus (3124) Google Scholar, 25Wilson T. Treisman R. Nature. 1988; 366: 396-399Crossref Scopus (506) Google Scholar, reviewed in Ref. 19Greenberg M.E. Belasco J.G. Belasco J.G. Brawerman G. Control of Messenger RNA Stability. Academic Press, New York1993: 199-218Crossref Google Scholar), and thus function as cis-acting elements important in post-transcriptional gene expression. The ARE have been shown to serve as binding sites for cytoplasmic and nuclear proteins (AU-rich binding proteins; AUBP) that may function as trans-acting factors in regulating ARE-dependent mRNA turnover and translation (26Bohjanen P.R. Petryniak B. June C.H. Thompson C.B. Lindsten T. Mol. Cell. Biol. 1991; 11: 3288-3295Crossref PubMed Scopus (233) Google Scholar, 27Brewer G. Mol. Cell. Biol. 1991; 11: 2460-2466Crossref PubMed Scopus (406) Google Scholar, 28Levine T.D. Gao F. King P.H. Andrews L.G. Keene J.D. Mol. Cell. Biol. 1993; 13: 3494-3504Crossref PubMed Scopus (335) Google Scholar, 29Malter J.S. Science. 1989; 246: 664-666Crossref PubMed Scopus (371) Google Scholar, 30Myer V.E. Lee S.I. Steitz J.A. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1296-1300Crossref PubMed Scopus (58) Google Scholar, 31Rajagopalan L.E. Malter J.S. J. Biol. Chem. 1994; 269: 23882-23888Abstract Full Text PDF PubMed Google Scholar, 32Vakalopoulou E. Schaack J. Shenk T. Mol. Cell. Biol. 1991; 11: 3355-3364Crossref PubMed Scopus (204) Google Scholar). A major component of ARE binding activity in activated lymphocytes, the 35-kDa AUBP, was shown by immunoprecipitation to contain hnRNP A1, although the presence of other co-migrating proteins could not be excluded. Other studies have suggested the functional relevance of cytoplasmic hnRNP A1-mRNA interactions in terms of mRNA stability. RNA polymerase II inhibition decreases ARE-dependent mRNA turnover of c-fos mRNA (33Shyu A.-B. Greenberg M.E. Belasco J.G. Genes Dev. 1989; 3: 60-72Crossref PubMed Scopus (452) Google Scholar), paralleling the marked increase in cytoplasmic hnRNP A1 levels (14Pinol-Roma S. Dreyfuss G. Nature. 1992; 355: 730-732Crossref PubMed Scopus (742) Google Scholar, 18Hamilton B.J. Nagy E. Malter J.S. Arrick B.A. Rigby W.F.C. J. Biol. Chem. 1993; 268: 8881-8887Abstract Full Text PDF PubMed Google Scholar). In addition, stabilization of interleukin-2 mRNA turnover in the MLA-144 cell line is associated with a proviral insertion that enhanced hnRNP A1 binding to its ARE relative to native interleukin-2 or GM-CSF (34Chen S.J. Holbrook N.J. Mitchell K.F. Vallone C.A. Greengard J.S. Crabtree G.R. Lin Y. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 7284-7289Crossref PubMed Scopus (44) Google Scholar, 35Henics T. Sanfridson A. Hamilton B.J. Nagy E. Rigby W.F.C. J. Biol. Chem. 1994; 269: 5377-5383Abstract Full Text PDF PubMed Google Scholar). Increased ARE binding by hnRNP A1 thus correlated with mRNA stability in vivo, similar to observations made with AUBF, a similarly sized protein, in an in vitro model of ARE-dependent mRNA turnover (31Rajagopalan L.E. Malter J.S. J. Biol. Chem. 1994; 269: 23882-23888Abstract Full Text PDF PubMed Google Scholar). These past studies generated several important questions regarding the cytoplasmic 35-kDa AUBP/hnRNP A1 and regulation of its RNA binding specificity in terms of understanding ARE-dependent mRNA turnover. Is the cytoplasmic 35-kDa AUBP activity made up of other proteins besides hnRNP A1 (17Nagy E. Rigby W.F.C. J. Biol. Chem. 1995; 270: 2755-2763Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar, 36Katz D.A. Theodorakis N.G. Cleveland D.W. Lindsten T. Thompson C.B. Nucleic Acids Res. 1994; 22: 238-246Crossref PubMed Scopus (68) Google Scholar)? If hnRNP A1 is an important cytoplasmic AUBP, do its cytoplasmic and nuclear forms differ in their RNA binding specificity? Third, what modulates the quantitative increase in cytoplasmic hnRNP A1 that accompanies RNA polymerase II inhibition and how is this affect transduced? In this paper, we establish that hnRNP A1 (or closely related proteins that are post-translationally regulated in an identical manner) is the dominant cytoplasmic protein capable of interacting with the ARE contained within full-length GM-CSF mRNA. Moreover, AUBP activity of cytoplasmic and nuclear hnRNP A1 are differentially regulated: RNA polymerase II inhibition appears to increase the binding specificity of cytoplasmic hnRNP A1 for ARE relative to other RNA ligands to a greater degree than its nuclear counterpart. Metabolic labeling and phosphatase inhibitor studies indicate that RNA binding by cytoplasmic hnRNP A1 is regulated by serine-threonine phosphorylation. These findings are relevant to the regulation of RNA-protein interactions as well as the specific ability of hnRNP A1 to serve distinct roles in post-transcriptional regulation of gene expression in both the nucleus and cytoplasm. Actinomycin D, diamide,N-ethylmaleimide, β-mercaptoethanol, and trypsin were purchased from Sigma. Poly(U)-Sepharose and cyanogen bromide-activated Sepharose beads were purchased from Pharmacia Biotech Inc. [α-32P]UTP (3000 Ci/mmol) was purchased from NEN Life Science Products, while [ortho-32P]H3PO4(400–800 mCi/ml) was purchased from ICN. Unlabeled nucleotides, Pefabloc, leupeptin, and pepstatin A were purchased from Boehringer Mannheim. Okadaic acid was purchased from LC Laboratories. The monoclonal antibody 4B10 and recombinant hnRNP A1 used in some studies was generously provided by Gideon Dreyfuss. Additional recombinant hnRNP A1 was expressed from cDNA (generously provided by Benoit Chabot) cloned into pGEX-2T (Pharmacia), affinity purified with glutathione-Sepharose, and stored in 10% glycerol at −80 °C. Cytoplasmic preparations were performed as described previously and characterized for their lack of contamination by nuclear proteins (18Hamilton B.J. Nagy E. Malter J.S. Arrick B.A. Rigby W.F.C. J. Biol. Chem. 1993; 268: 8881-8887Abstract Full Text PDF PubMed Google Scholar). Human peripheral blood mononuclear cells obtained from volunteer donors by leukapheresis were isolated by Ficoll-Hypaque discontinuous gradient centrifugation and cultured at 4 × 106/ml in RPMI 1640 medium (Cellgro) supplemented with 8% heat-inactivated (56 °C, 1 h) neonatal bovine serum (Sigma) and 50 μg/ml gentamycin sulfate (U. S. Biochemical Corp.) at 37 °C in a humidified atmosphere of 5% CO2 in air. Cells were stimulated with that concentration of phytohemagglutinin (PHA) (1 μg/ml, Wellcome Reagent Ltd., Beckenham, United Kingdom) found to cause maximal stimulation. Cytoplasmic lysates were prepared by washing the cells twice in ice-cold phosphate-buffered saline. All reagents and subsequent steps were used at 4 °C. The cells were lysed by gentle resuspension in 1% Triton X-100 lysis buffer (50 μl/2 × 107 cells) containing 10 mm PIPES, pH 6.8, 100 mm KCl, 2.5 mm MgCl2, 300 mm sucrose, 1 mm Pefabloc, and 2 μg/ml each of leupeptin and pepstatin A before a 3-min incubation followed by 3 min centrifugation at 500 × g. The supernatant was aliquoted and stored at −80 °C as the cytoplasmic fraction. The pellet was gently resuspended in lysis buffer and spun through a 30% sucrose cushion twice. The nuclear pellet was gently resuspended with 0.5 nuclei pellet volume of low salt buffer containing 10 mm Tris-HCl, pH 7.6, 20 mm KCl, 1.5 mm MgCl2, 0.5 μm dithiothreitol, 0.2 mm EDTA, 25% glycerol, 2 mm Pefabloc, 1 μg/ml each leupeptin and pepstatin A. While vortexing gently, 1.5 volume of nuclei pellet of high salt buffer (identical to the low salt buffer except for the presence of 0.5 m KCl) was added dropwise (37Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9164) Google Scholar). Samples were gently rocked for 30 min before centrifuging at 12,000 ×g for 30 min. The supernatant was aliquoted and stored at −80 °C as the nucleoplasmic fraction. The XhoI fragment of pXM vector containing the human GM-CSF DNA (provided by Genetics Institute) was subcloned into the multiple cloning site of the pT7/T3α19 vector (Life Technologies, Inc.) at the BamHI site. The GM-CSF RNA probe was generated by T7 RNA polymerase transcription of this plasmid linearized with EcoRI. The Δ2R1 probe, which contains a sequence found in the 3′-untranslated region of GM-CSF mRNA, was prepared by T7 RNA polymerase transcription of EcoRI-linearized pT7/T3α19 vector with 4 reiterated AUUUA sequences in the BamHI site of the multiple cloning site, with the antisense transcript containing 4 UAAAU sequences called Δ2H3 (29Malter J.S. Science. 1989; 246: 664-666Crossref PubMed Scopus (371) Google Scholar). Δ2R1:U→C has 4 reiterated AUCUA instead of AUUUA sequences. Each was generously provided by James Malter (29Malter J.S. Science. 1989; 246: 664-666Crossref PubMed Scopus (371) Google Scholar). The β-globin probe was generated by T3 RNA polymerase transcription of AvaII linearized T7/T3 α19 vector with the genomic β-globin cloned into the PstI site. DUP33Y5 was generated by SP6 RNA polymerase transcription of BamHI linearized DUP33Y5 (plasmid generously provided by R. Kole, Ref.38Dominski Z. Kole R. Mol. Cell. Biol. 1991; 11: 6075-6083Crossref PubMed Scopus (180) Google Scholar). α-32P-Labeled mRNAs with specific activity of >108 cpm/mg RNA were prepared by in vitrotranscription in the presence of 50 μCi of [α-32P]UTP (3000 Ci/mmol) from NEN Life Science Products, 0.0125 mmUTP, 2.5 mm ATP, GTP, and CTP from Boehringer Mannheim. RNA probes (8 × 104 cpm; 3–14 fmol calculation based on [α-32P]UTP incorporation) were incubated with 10–20 μg of cytoplasmic extract or 2–5 μg of nucleoplasmic extract in 12 mm Hepes, pH 7.9, 15 mm KCl, 0.2 μm dithiothreitol, 0.2 μg/ml yeast tRNA, and 10% glycerol for 10 min at 30 °C. UV cross-linking was performed at 4 °C using a Stratagene UV Stratalinker 1800 (5 min, 3000 microwatts/cm2) followed by RNase digestion (10 units of RNase T1 and 20 μg of RNase A) for 30 min at 37 °C (18Hamilton B.J. Nagy E. Malter J.S. Arrick B.A. Rigby W.F.C. J. Biol. Chem. 1993; 268: 8881-8887Abstract Full Text PDF PubMed Google Scholar). The sample was analyzed under denaturing conditions by 12% SDS-PAGE and either dried on a gel dryer or transferred to nitrocellulose (Schleicher & Schuell, 0.4 μm) in 10 mm CAPS, pH 11.0, 15% methanol using Idea Scientific Co. transfer apparatus at 20 V × 1.5 h followed by autoradiography. Electrophoretic mobility shift assays were performed as described previously (39Tsukamoto H. Boado R.J. Pardridge W.M. J. Clin. Invest. 1996; 97: 2823-2832Crossref PubMed Scopus (37) Google Scholar). Cytoplasmic extracts prepared from 20-h PHA (1 μg/ml) + 2-h actinomycin D (5 μg/ml) were incubated with32P-GM-CSF (8 × 104 cpm), UV cross-linked, and digested with RNase as described above. RNA-protein complexes were incubated with 15 ng of trypsin (2000:1, w/w) in 50 mm Tris-HCl, pH 8.0, 325 mm NaCl, 1 mm EDTA, 1 mm phenylmethylsulfonyl fluoride (Boehringer Mannheim), and 1 μg/ml pepstatin A for 1, 2, or 3 h at room temperature. Trypsin digestion was stopped by the addition of SDS-PAGE sample buffer and boiling followed by analysis under denaturing conditions by 12% SDS-PAGE. Assays were performed as described previously (5Swanson M.S. Dreyfuss B. Mol Cell. Biol. 1988; 8: 2237-2241Crossref PubMed Scopus (251) Google Scholar). Cytoplasmic (100 μg) or nucleoplasmic (25 μg) extracts prepared from 20-h PHA + 2-h actinomycin D (5 μg/ml) or ethanol control were incubated with poly(U)-Sepharose beads in 12 mm Hepes pH 7.9, 0.2 μm dithiothreitol, 0.2 μg/ml yeast tRNA, and the specified concentration of NaCl for 15 min at room temperature with gentle agitation. The quantity of poly(U)-Sepharose beads (50 μl packed) used was in excess of the amount capable of completely depleting all hnRNP A1 from lysates when incubated in the absence of salt. Beads were washed extensively with the same binding buffer (6 × 500 μl) before addition of SDS-PAGE sample buffer and boiling. Samples were analyzed by 12% SDS-PAGE denaturing gel. Proteins were electrotransferred as described above and immunoblotted with 4B10 to detect hnRNP A1. Similar results were obtained with cytoplasmic lysates whose total hnRNP A1 levels were adjusted to have equivalent levels of hnRNP A1 between control and actinomycin D-treated samples. Two-dimensional NEPHGE was done as described by O'Farrell et al. (40O'Farrell P.Z. Goodman H.M. O'Farrell P.H. Cell. 1977; 12: 1133-1142Abstract Full Text PDF PubMed Scopus (2583) Google Scholar). 100 μg of cytoplasmic extracts were separated in the first dimension with pH 3–10 ampholines (Bio-Rad) at 400 V for 135 min (900 volt-h). The second dimension was reducing denaturing 12% SDS-PAGE. Proteins were electrotransferred as described above followed by autoradiography or immunoblotting. Polyclonal antibody to the C-terminal 18 amino acids of hnRNP A1 (ACT-1) was raised in a rabbit through immunization with KLH-C-terminal peptide complex, where disulfide linkage of the N-terminal cysteine of the synthesized peptide CGYGGSSSSSSYGSGRRF was used to couple the peptide to KLH. Rabbit antiserum obtained was affinity purified by passage over a Sulfolink column (Pierce) to which disulfide linkage of the peptide had been used to immobilize the peptide. Eluted antibody was specific for hnRNP A1 and did not react with any other hnRNP proteins. Affinity-purified antibody was covalently cross-linked to cyanogen bromide-activated Sepharose beads per manufacturer's instructions (Pharmacia). Human peripheral blood lymphocytes (1 × 108) were cultured as described above for 20 h before washing four times with phosphate-free medium. Cells were cultured 1 h in phosphate-free RPMI (Bio-Labs, Rockville, MD) plus 10% dialyzed fetal calf serum before addition of 10 mCi of [ortho-32P]H3PO4 for 3.5 h. Actinomycin D (5 μg/ml) or ethanol control was added for 2 h before preparing cytoplasmic extracts. Extracts were precleared with protein A-Sepharose beads before immunoprecipitation with ACT-1-Sepharose beads for 4 h at 4 °C on rotator in 10 mm Tris-HCl, pH 7.4, 100 mm NaCl, 2.5 mm MgCl2, 0.5% Triton X-100, 1 mmPefabloc, and 1 μg/ml each of leupeptin and pepstatin A. The beads were washed extensively before addition of SDS-PAGE sample buffer and boiling. Samples were electrophoresed by 12% SDS-PAGE and electrotransferred to nitrocellulose before autoradiography and immunoblotting. Under these conditions, lysates are cleared of all immunoreactive hnRNP A1, as measured by Western blotting of immunodepleted lysates with 4B10 or ACT-1. The relative RNA binding specificity of cytoplasmic hnRNP A1 from mitogenic lectin-PHA-activated human T lymphocytes for ARE and 3′-intron splice sites was initially analyzed by incubation with radiolabeled [32P]UTP-RNA (full-length GM-CSF mRNA and β-globin pre-mRNA shown in TableI) followed by UV cross-linking, RNase digestion, SDS-PAGE, and electroblotting on nitrocellulose (Fig.1), as previously described (18Hamilton B.J. Nagy E. Malter J.S. Arrick B.A. Rigby W.F.C. J. Biol. Chem. 1993; 268: 8881-8887Abstract Full Text PDF PubMed Google Scholar). Cytoplasmic lysates demonstrated qualitative differences in their RNA binding profile relative to previous studies with oligoribonucleotide probes containing ARE (18Hamilton B.J. Nagy E. Malter J.S. Arrick B.A. Rigby W.F.C. J. Biol. Chem. 1993; 268: 8881-8887Abstract Full Text PDF PubMed Google Scholar). Notably, a 35-kDa protein appeared to be the major protein labeled by UV cross-linking following incubation with full-length GM-CSF, which colocalized with hnRNP A1 by subsequent immunoblotting. Second, this 35-kDa complex demonstrated a much higher degree of labeling (reflecting binding and subsequent UV cross-linking) with GM-CSF relative to that seen with a β-globin pre-mRNA transcript.Table IRNA sequences used in AUBP assaysRNA sequencesΔ2R15′-GGAUCCAUUUAUUUAUUUAUUUAAGCUUGG-3′Δ2R1:U → C5′-GGAUCCAUCUAUCUAUCUAUCUAAGCUUGG-3′Δ2H35′-CCUAGGUAAAUAAAUAAAUAAAUUCGAACC-3′GM-CSF5′-AUG-(N)597AAGAAUGGGAAUAUUUUAUACUGACAGAAAUCAGUAAUAUUUAUAUAUUUAUAUUUUUAAAAUAUUUAUUUAUUUAUUUAUUUAAGUUCAUAUUCCAUAUUUAUUCAAGAUGUUUUACCGUAAUAAUUAUAUUAAAAAUAUGCUUCUAAA–3′β-Globin5′-(N)246UUGGUAUCAAGGUUACAAGACAGGUUUAAGGAGACCAAUAGAAACUGGGCAUGUGGAGACAGAGAAGACUCUUGGGUUUCUGAUAGGCACUGACUCUCUCUGCCUAUUGGUCUAUUUUCCCACCCUUAG(N)23-3′DUP33Y55′-(N)246UUGGUAUCAAGGUUACAAGACAGGUUUAAGGAGACCAAUAGAAACUGGGCAUGUGGAGACAGAGAAGACUCUUGGGUUUCUGAUAGGCACUGA[CUCUCUCU C CCU U UU UC UCU U UUUUCCCACCCUUAG](N)33UUGGUAUCAAGGUUACAAGACAGGUUUAAGGAGACCAAUAGAAACUGGGCAUGUGGAGACAGAGAAGACUCUUGGGUUUCUGAUAGGCACUGACUCUCUCUGCCUAUUGGUCUAUUUUCCCACCCUUAG(N)210-3′The AUUUA sequences in GM-CSF and Δ2R1 are underlined. Δ2R1:U → C has reiterated AUCUA instead of AUUUA sequences. The β-globin probe contains the first intron and exon of human β-globin as well as the first 23 nucleotides of the second exon, shown as (N)23. The polypyrimidine tract at the 3′ end of the first intron of β-globin is underlined. The DUP33Y5 transcript contains 2 repeats of the first intron of β-globin, of which the latter is identical to that found in the first intron of β-globin pre-mRNA. The first intronic polypyrimidine tract (bracketed) of DUP33Y5 is mutated at sites (bold type, underlined) to contain oligouridine stretches of 5 and 6 bases each. These two intronic sequences are separated by 33 nucleotides (denoted as (N)33) which contains sequences of the first and second exon of β-globin (19Greenberg M.E. Belasco J.G. Belasco J.G. Brawerman G. Control of Messenger RNA Stability. Academic Press, New York1993: 199-218Crossref Google Scholar). Thus, DUP33Y5 is very similar to the β-globin, with two intronic sequences that are identical to that found in the β-globin probe, but for the presence of 28 uninterrupted pyrimidines in the first. Open table in a new tab The AUUUA sequences in GM-CSF and Δ2R1 are underlined. Δ2R1:U → C has reiterated AUCUA instead of AUUUA sequences. The β-globin probe contains the first intron and exon of human β-globin as well as the first 23 nucleotides of the second exon, shown as (N)23. The polypyrimidine tract at the 3′ end of the first intron of β-globin is underlined. The DUP33Y5 transcript contains 2 repeats of the first intron of β-globin, of which the latter is identical to that found in the first intron of β-globin pre-mRNA. The first intronic polypyrimidine tract (bracketed) of DUP33Y5 is mutated at sites (bold type, underlined) to contain oligouridine stretches of 5 and 6 bases each. These two intronic sequences are separated by 33 nucleotides (denoted as (N)33) which contains sequences of the first and second exon of β-globin (19Greenberg M.E. Belasco J.G. Belasco J.G. Brawerman G. Control of Messenger RNA Stability. Academic Press, New York1993: 199-218Crossref Google Scholar). Thus, DUP33Y5 is very similar to the β-globin, with two intronic sequences that are identical to that found in the β-globin probe, but for the presence of 28 uninterrupted pyrimidines in the first. Following actinomycin D treatment, increased 35-kDa GM-CSF and β-globin binding activity was observed, but the relative binding intensity of these two RNA probes was maintained. Relative to the other proteins (68, 50, and 40 kDa) bound and labeled by these RNA, the cytoplasmic 35-kDa protein demonstrated not only the greatest level of binding, but also the greatest differential of labeling between the GM-CSF and β-globin pre-mRNA transcripts. In other experiments, the cytoplasmic 35-kDa AUBP consistently bound more effectively to β-globin than DUP33Y5 pre-mRNA (data not shown). The DUP33Y5 pre-mRNA transcript contains two 3′-splice sites, the distal one identical to that contained in the β-globin pre-mRNA, while its proximal site contains several oligouridine sequences (Table I), thereby controlling for oligouridine-dependent effects on RNA binding and cross-linking. From these studies, we infer that the increased binding of the 35-kDa AUBP to the GM-CSF mRNA sequence relative to β-globin pre-mRNA cannot be accounted for by the presence of o