Damaging Alleles Affecting Multiple CARD14 Domains Are Associated with Palmoplantar Pustulosis

Palmoplantar pustulosis (PPP) is a severe pustular eruption that affects the palms and/or soles, with detrimental effects on quality of life. The disease is notoriously difficult to treat because its immune and genetic determinants remain poorly defined (Twelves et al., 2019Twelves S. Mostafa A. Dand N. Burri E. Farkas K. Wilson R. et al.Clinical and genetic differences between pustular psoriasis subtypes.J Allergy Clin Immunol. 2019; 143: 1021-1026Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar). Although mutations of the IL36RN and myeloperoxidase MPO genes have been convincingly associated with generalized pustular psoriasis, they are rarely found in patients with PPP (Haskamp et al., 2020Haskamp S. Bruns H. Hahn M. Hoffmann M. Gregor A. Löhr S. et al.Myeloperoxidase modulates inflammation in generalized pustular psoriasis and additional rare pustular skin diseases.Am J Hum Genet. 2020; 107: 527-538Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar; Twelves et al., 2019Twelves S. Mostafa A. Dand N. Burri E. Farkas K. Wilson R. et al.Clinical and genetic differences between pustular psoriasis subtypes.J Allergy Clin Immunol. 2019; 143: 1021-1026Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar; Vergnano et al., 2020Vergnano M. Mockenhaupt M. Benzian-Olsson N. Paulmann M. Grys K. Mahil S.K. et al.Loss-of-function myeloperoxidase mutations are associated with increased neutrophil counts and pustular skin disease.Am J Hum Genet. 2020; 107 ([published correction appears in Am J Hum Genet 2021;108:757]): 539-543Abstract Full Text Full Text PDF PubMed Google Scholar). Further candidate genes therefore need to be examined. CARD14 encodes a keratinocyte scaffold protein that mediates NF-κB signaling downstream of TRAF2 and TRAF6. Activating CARD14 mutations have been documented in a variety of inflammatory skin disorders, including familial psoriasis, erythrodermic psoriasis, generalized pustular psoriasis, pityriasis rubra pilaris, and CARD14-associated papulosquamous eruption (Berki et al., 2015Berki D.M. Liu L. Choon S.E. David Burden A. Griffiths C.E.M. Navarini A.A. et al.Activating CARD14 mutations are associated with generalized pustular psoriasis but rarely account for familial recurrence in psoriasis vulgaris.J Invest Dermatol. 2015; 135: 2964-2970Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar; Fuchs-Telem et al., 2012Fuchs-Telem D. Sarig O. van Steensel M.A. Isakov O. Israeli S. Nousbeck J. et al.Familial Pityriasis rubra pilaris is caused by mutations in CARD14.Am J Hum Genet. 2012; 91: 163-170Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar; Jordan et al., 2012bJordan C.T. Cao L. Roberson E.D. Pierson K.C. Yang C.F. Joyce C.E. et al.PSORS2 is due to mutations in CARD14.Am J Hum Genet. 2012; 90: 784-795Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar; Nieto-Benito et al., 2020Nieto-Benito L.M. Baniandrés-Rodríguez O. Moreno-Torres A. Hernández-Martín A. Torrelo-Fernández A. Campos-Domínguez M. Clinical response to ustekinumab in CARD14-associated papulosquamous eruption (CAPE) with a new missense mutation in CARD14: a case report and systematic review.J Eur Acad Dermatol Venereol. 2020; 34: e728-e730Crossref PubMed Scopus (8) Google Scholar; Signa et al., 2019Signa S. Campione E. Rusmini M. Chiesa S. Grossi A. Omenetti A. et al.Whole exome sequencing approach to childhood onset familial erythrodermic psoriasis unravels a novel mutation of CARD14 requiring unusual high doses of ustekinumab.Pediatr Rheumatol Online J. 2019; 17: 38Crossref PubMed Scopus (15) Google Scholar). More recently, loss-of-function CARD14 alleles have been observed in a small number of patients with severe atopic dermatitis, further extending the spectrum of CARD14-associated diseases (Peled et al., 2019Peled A. Sarig O. Sun G. Samuelov L. Ma C.A. Zhang Y. et al.Loss-of-function mutations in caspase recruitment domain-containing protein 14 (CARD14) are associated with a severe variant of atopic dermatitis.J Allergy Clin Immunol. 2019; 143: 173-181.e10Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). In this study, we investigated the possibility that CARD14 variants might also be associated with PPP. We examined 236 unrelated cases of European descent, recruited through United Kingdom dermatology departments participating in the APRICOT clinical trial (approved by the London Dulwich Research Ethics Committee; reference 16/LO/0436 [Cro et al., 2021Cro S. Cornelius V.R. Pink A.E. Wilson R. Pushpa-Rajah A. Patel P. et al.Anakinra for palmoplantar pustulosis: results from a randomized, double-blind, multicentre, two-staged, adaptive placebo-controlled trial (APRICOT).Br J Dermatol. 2021; 186: 245-256Crossref PubMed Scopus (13) Google Scholar]) or its sister research study PLUM (approved by the London Bridge Research Ethics Committee; reference 16/LO/2190) (Supplementary Table S1). PPP was diagnosed by dermatologists in line with the consensus criteria set by the European Rare And Severe Psoriasis Expert Network (Navarini et al., 2017Navarini A.A. Burden A.D. Capon F. Mrowietz U. Puig L. Köks S. et al.European consensus statement on phenotypes of pustular psoriasis.J Eur Acad Dermatol Venereol. 2017; 31: 1792-1799Crossref PubMed Scopus (235) Google Scholar). The study was undertaken in accordance with the declaration of Helsinki, and all participants granted their written informed consent. CARD14 variants were identified by querying whole-exome sequence profiles generated on an Illumina HiSeq2000 instrument (n = 212) or by Sanger sequencing the gene coding region and exon/intron junctions (n = 24). Rare changes (minor allele frequency < 1%) were assessed using three independent algorithms (see Supplementary Materials and Methods), and those that were classified as damaging by at least two predictors were considered potentially pathogenic. This approach identified eight deleterious variants, affecting 12 unrelated individuals (Table 1). Meanwhile, an analysis of 62,222 controls (non-Finnish European dataset) sequenced by the gnomAD consortium identified 1,123 rare alleles that met the same pathogenicity criteria. Fisher's exact test showed that the CARD14 mutational burden was significantly different in the two groups (2.5 vs. 0.9%; P = 1.5 × 10‒3; OR = 2.9, 95% confidence interval = 1.5‒5.1), showing an association between rare CARD14 alleles and PPP. Importantly, the frequency of rare and synonymous CARD14 changes was comparable in cases and controls (P > 0.05), showing that there were no systematic differences between our patient population and the external control dataset.Table 1Rare- and Low-Frequency CARD14 Variants Detected in PPP CasesRs NumberAmino Acid SubstitutionMinor Allele Frequency1Frequency among non-Finnish Europeans, gnomAD 2.1.1.Pathogenicity PredictionsOccurrencesCADD Score2Variants with CADD scores > 15 are considered deleterious.PROVEANMutationTasterSplicemanConsensusrs143747620p.Lys78Asn0.000425.0NeutralPolymorphism—Benign1—p.Ile86Met—17.7NeutralPolymorphism—Benign1rs372403419p.Arg182Cys0.0000922.7NeutralDisease causing—Deleterious1rs200790561p.Glu197Lys0.000727.3DeleteriousDisease causing—Deleterious1rs375882704p.Ala367Thr0.0000924.0NeutralPolymorphism—Benign1rs150536049p.Ser378Arg0.00214.8DeleteriousPolymorphism—Benign1rs780034490p.Ser384Phe0.00000923.3DeleteriousPolymorphism—Deleterious2rs200102454p.Thr591Met0.0000824.3NeutralDisease causing—Deleterious1rs73429414p.Arg597Trp0.0000725.8NeutralDisease causing—Deleterious1rs371910172p.Arg610Cys0.0000324.7NeutralDisease causing—Deleterious1rs138833596p.Val774Ile0.000116.9NeutralDisease causing—Deleterious1rs2289541p.Arg883His0.00028.1NeutralPolymorphism—Benign1rs146678380c.2569+4T>C0.0033.0—Disease causingDeleteriousDeleterious4rs61751629p.Glu422Lys0.03314.8NeutralPolymorphism—Benign25rs117918077p.Arg682Trp0.01635.0DeleteriousDisease causing—Deleterious13Low-frequency variants are reported in the two bottom rows. We reported the p.Arg182Cys and p.Thr591Met deleterious alleles in a previous study (Twelves et al., 2019Twelves S. Mostafa A. Dand N. Burri E. Farkas K. Wilson R. et al.Clinical and genetic differences between pustular psoriasis subtypes.J Allergy Clin Immunol. 2019; 143: 1021-1026Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar).Abbreviations: CADD, Combined Annotation Dependent Depletion; PPP, palmoplantar pustulosis.1 Frequency among non-Finnish Europeans, gnomAD 2.1.1.2 Variants with CADD scores > 15 are considered deleterious. Open table in a new tab Low-frequency variants are reported in the two bottom rows. We reported the p.Arg182Cys and p.Thr591Met deleterious alleles in a previous study (Twelves et al., 2019Twelves S. Mostafa A. Dand N. Burri E. Farkas K. Wilson R. et al.Clinical and genetic differences between pustular psoriasis subtypes.J Allergy Clin Immunol. 2019; 143: 1021-1026Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar). Abbreviations: CADD, Combined Annotation Dependent Depletion; PPP, palmoplantar pustulosis. We next examined low-frequency CARD14 variants, identifying multiple occurrences of a known p.Arg682Trp substitution (Jordan et al., 2012aJordan C.T. Cao L. Roberson E.D. Duan S. Helms C.A. Nair R.P. et al.Rare and common variants in CARD14, encoding an epidermal regulator of NF-kappaB, in psoriasis.Am J Hum Genet. 2012; 90: 796-808Abstract Full Text Full Text PDF PubMed Scopus (285) Google Scholar) (Table 1). This change was also more common in cases than in controls (2.7 vs. 1.6%; P = 0.044; OR = 1.7; 95% confidence interval = 1.0‒3.0). Although our dataset was not powered for subgroup analysis, we found that CARD14 mutations were not restricted to a particular demographic (i.e., females or smokers) and were detectable regardless of plaque psoriasis affection status (Supplementary Table S2). Of note, this argues against the suggestion that PPP presenting with concurrent psoriasis might have a distinct genetic etiology (Murakami and Terui, 2020Murakami M. Terui T. Palmoplantar pustulosis: current understanding of disease definition and pathomechanism.J Dermatol Sci. 2020; 98: 13-19Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). To better understand the significance of our association findings, we compared the location of the rare damaging changes detected in PPP cases with that of known CARD14 mutations. We first carried out a systematic literature review, which identified 61 CARD14 genetic studies (Supplementary Figure S1), reporting a total of 65 rare variants. We then assessed the deleterious potential of each change on the basis of their predicted pathogenicity, recurrence, and segregation (see Supplementary Materials and Methods). This identified 18 variants that were likely to be deleterious (Supplementary Table S3). Strikingly, all damaging missense alleles clustered to two specific gene regions (Supplementary Figure S2). The gain-of-function mutations described in familial psoriasis, generalized pustular psoriasis, pityriasis rubra pilaris, and CARD14-associated papulosquamous eruption mapped between amino acids 117 and 197, affecting the CARD14 coiled‒coil and the preceding linker region. Conversely, the recurrent loss-of-function allele documented in atopic dermatitis lies within the PDZ domain (residue 593). Interestingly, the damaging missense changes detected in PPP cases were found in both mutation hot spots. Three variants (p.Arg182Cys, p.Glu197Lys, and p.Ser384Phe) localized to the coiled‒coil and three to the PDZ domain (p.Thr591Met, p.Arg597Trp, p.Arg610Cys), with one substitution mapping to the C-terminal linker region (p.Val774Ile) (Supplementary Figure S2). These data suggest that PPP is associated with both gain- and loss-of-function CARD14 alleles. To further investigate this possibility, we overexpressed mutagenized cDNA constructs harboring representative coiled‒coil (p.Arg182Cys, p.Ser384Phe) and PDZ (p.Thr591Met) variants. We found that the p.Arg182Cys and p.Ser384Phe alleles led to the formation of insoluble CARD14 aggregates (Figure 1a). Because these promote constitutive NF-κB activation (Berki et al., 2015Berki D.M. Liu L. Choon S.E. David Burden A. Griffiths C.E.M. Navarini A.A. et al.Activating CARD14 mutations are associated with generalized pustular psoriasis but rarely account for familial recurrence in psoriasis vulgaris.J Invest Dermatol. 2015; 135: 2964-2970Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar), the two variants are very likely to have gain-of-function properties. Conversely, we observed that the p.Thr591Met substitution was associated with reduced protein accumulation (Figure 1b), indicating a loss-of-function effect. Interestingly, the notion that variants with opposing effects can result in the same clinical phenotype is supported by the characterization of CARD14 alleles associated with plaque psoriasis. This identified both gain- and loss-of-function changes, suggesting that CARD14 activity levels need to be finely balanced to maintain skin immune homeostasis (Jordan et al., 2012aJordan C.T. Cao L. Roberson E.D. Duan S. Helms C.A. Nair R.P. et al.Rare and common variants in CARD14, encoding an epidermal regulator of NF-kappaB, in psoriasis.Am J Hum Genet. 2012; 90: 796-808Abstract Full Text Full Text PDF PubMed Scopus (285) Google Scholar). Importantly, this implies that CARD14 might be a problematic therapeutic target. Although CARD14 has been previously investigated in PPP, earlier studies were mostly restricted to the proximal coiled‒coil domain and had in retrospect limited the potential to detect disease alleles (Berki et al., 2015Berki D.M. Liu L. Choon S.E. David Burden A. Griffiths C.E.M. Navarini A.A. et al.Activating CARD14 mutations are associated with generalized pustular psoriasis but rarely account for familial recurrence in psoriasis vulgaris.J Invest Dermatol. 2015; 135: 2964-2970Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar; Mössner et al., 2017Mössner R. Wilsmann-Theis D. Oji V. Gkogkolou P. Löhr S. Schulz P. et al.The genetic basis for most patients with pustular skin disease remains elusive.British J Dermatol. 2017; 178: 740-748Crossref Scopus (0) Google Scholar). Of note, evidence gathered in other inflammatory conditions (e.g., pityriasis rubra pilaris and CARD14-associated papulosquamous eruption) indicates that IL-12p40 blockade (ustekinumab) may be effective in individuals with CARD14 mutations (Eytan et al., 2014Eytan O. Sarig O. Sprecher E. van Steensel M.A. Clinical response to ustekinumab in familial Pityriasis rubra pilaris caused by a novel mutation in CARD14.Br J Dermatol. 2014; 171: 420-422Crossref PubMed Scopus (54) Google Scholar; Nieto-Benito et al., 2020Nieto-Benito L.M. Baniandrés-Rodríguez O. Moreno-Torres A. Hernández-Martín A. Torrelo-Fernández A. Campos-Domínguez M. Clinical response to ustekinumab in CARD14-associated papulosquamous eruption (CAPE) with a new missense mutation in CARD14: a case report and systematic review.J Eur Acad Dermatol Venereol. 2020; 34: e728-e730Crossref PubMed Scopus (8) Google Scholar; Signa et al., 2019Signa S. Campione E. Rusmini M. Chiesa S. Grossi A. Omenetti A. et al.Whole exome sequencing approach to childhood onset familial erythrodermic psoriasis unravels a novel mutation of CARD14 requiring unusual high doses of ustekinumab.Pediatr Rheumatol Online J. 2019; 17: 38Crossref PubMed Scopus (15) Google Scholar). In this context, our work suggests that whole-gene mutational screens could identify patients with CARD14 disease alleles who may benefit from personalized ustekinumab treatment. All the patient allele frequency data are reported in the text and table of this manuscript. Control allele frequency data were retrieved from the gnomAD database. Athanasios Niaouris: http://orcid.org/0000-0002-8407-2014 Ariana Hernández-Cordero: http://orcid.org/0000-0002-4132-1949 Salma Haddad: http://orcid.org/0000-0002-8123-6853 Niina Karoliina Hassi: http://orcid.org/0000-0002-1548-1199 Natashia Benzian-Olsson: http://orcid.org/0000-0002-5287-7707 Carmen Bugarin Diz: http://orcid.org/0000-0001-6257-3734 A. David Burden: http://orcid.org/0000-0001-7395-9931 Hywel L. Cooper: http://orcid.org/0000-0001-8016-706X Christopher E.M. Griffiths: http://orcid.org/0000-0001-5371-4427 Richard Parslew: http://orcid.org/0000-0002-9430-1394 Andrew E. Pink: http://orcid.org/0000-0001-5151-5539 Nick J. Reynolds: http://orcid.org/0000-0002-6484-825X Shyamal Wahie: http://orcid.org/0000-0003-2798-8429 Richard B. Warren: http://orcid.org/0000-0002-2918-6481 Andrew Wright: http://orcid.org/0000-0002-6072-5148 Michael Simpson: http://orcid.org/0000-0002-8539-8753 Patrick Baum: http://orcid.org/0000-0002-1399-8610 Sudha Visvanathan: http://orcid.org/0000-0002-1170-9272 Jonathan N. Barker: http://orcid.org/0000-0002-9030-183X Catherine H. Smith: http://orcid.org/0000-0001-9918-1144 Francesca Capon: http://orcid.org/0000-0003-2432-5793 Conceptualization: FC; Formal Analysis: AN, AHC, CBD, SH, NBO; Funding Acquisition: FC, CHS, PB, SV; Resources: ADB, HLC, CEMG, RP, AEP, NJR, MS, SW, RBW, AW, JNB, CHS; Investigation: AN, NKH; Supervision: FC; Writing - Original Draft Preparation: FC FC has received research funding from Boehringer-Ingelheim. JNB has received research grants and consultation fees from Boehringer-Ingelheim and Anaptyis Bio. CTW, PB, and SV are Boehringer-Ingelheim employees. HLC has received honoraria for participating in advisory boards or sponsorship to attend conferences from AbbVie, Almirall, Janssen, Leo Pharma, Lilly, Novartis, Sanofi, and UCB. RBW has received research grants and/or consultancy fees from AbbVie, Almirall, Amgen, Arena, Astellas, Avillion, Biogen, Boehringer Ingelheim, Bristol Myers Squibb, Celgene, DiCE, GSK, Janssen, Lilly, Leo, Medac, Novartis, Pfizer, Sanofi, Sun Pharma, UCB, and UNION therapeutics. SW has received nonfinancial support (sponsorship to attend conferences) from AbbVie, Almirall, Janssen, Novartis, and UCB. ADB reports honoraria for consultancy, research, and lecturing from Boehringer Ingelheim and Novartis. AEP has acted as an investigator, speaker, or advisor or received educational grants from Pfizer, AbbVie, Leo, Sanofi, Galderma, Lilly, Novartis, Janssen, Amgen, Celgene, Almirall, La Roche Posay, UCB, Bristol Myers Squibb, and Boehringer-Ingelheim. NJR reports ongoing Novartis Grant (Signature) income to Newcastle University. NJR reports consultancies/invited lectures for Boehringer Ingelheim (2022), Janssen Cilag (2022), and AbbVie (2021); the Lilly UK Atopic Dermatitis Advisory Board (2020); and the European Society for Dermatological Research 2019 Celgene Sponsored Symposium, with income to Newcastle University (no personal income). CHS is an investigator on public/private partnership consortia investigating biomarkers of outcome in psoriasis and atopic dermatitis with multiple industry partners (www.biomap-imi.eu/; psort.org.uk) and reports departmental income for research and education from industry manufacturing therapeutics in psoriasis, including Leo, Novartis, and AbbVie. Membership of the APRICOT and PLUM study team is reported in the Supplementary Materials and Methods. This research was supported by the National Institute for Health and Care Research (NIHR) Biomedical Research Centre based at Guy's and St Thomas' NHS Foundation Trust and King's College London (London, United Kingdom) (guysbrc-2012-1). We also acknowledge support from the Newcastle NIHR Biomedical Research Centre. The APRICOT trial was funded by the Efficacy and Mechanism Evaluation Programme, a Medical Research Council, and NIHR partnership (grant Efficacy and Mechanism Evaluation 13/50/17). This work was supported by the European Academy of Dermatology and Venereology (grant PPRC-2018-25) and the Psoriasis Association (grants BSTOP50/5, ST1/17, and ST3/20). NBO was funded by an NIHR pre-doctoral fellowship (NIHR300473), and SH was funded by an Isaac Schapera Research Trust award. CEMG is funded in part by the NIHR Manchester Biomedical Research Centre and is an NIHR Emeritus Senior Investigator. NJR is an NIHR Senior Investigator. RBW is supported by the Manchester NIHR Biomedical Research Centre. The views expressed are those of the author(s) and not necessarily those of the NHS, the NIHR, or the Department of Health and Social Care. The members of the APRICOT and PLUM include the following: Thamir Abraham (Peterborough City Hospital, Peterborough, United Kingdom), Muhmad Ali (Worthing Hospital, Worthing, United Kingdom), Suzannah August (Poole Hospital NHS Foundation Trust, Poole, United Kingdom), David Baudry (Guy's and St Thomas' NHS Foundation Trust, London, United Kingdom), Gabrielle Becher (NHS Greater Glasgow and Clyde, Glasgow, United Kingdom), Anthony Bewley (Whipps Cross Hospital, London, United Kingdom), Victoria Cornelius (Imperial College London, London, United Kingdom), Giles Dunnill (University Hospitals Bristol NHS Foundation Trust, Bristol, United Kingdom), Adam Ferguson (Royal Derby Hospital, Derby, United Kingdom), Sharizan Ghaffar (Ninewells Hospital and Medical School, Dundee, United Kingdom), John Ingram (University Hospital of Wales, Cardiff, United Kingdom), Svetlana Kavakleiva (Royal Lancaster Infirmary, Lancaster, United Kingdom), Susan Kelly (The Royal Shrewsbury Hospital, United Kingdom), Mohsen Khorshid (Basildon Hospital, Basildon, United Kingdom), Helen Lachmann (Royal Free Hospital, London, United Kingdom), Effie Ladoyanni (Russels Hall Hospital, Dudley, United Kingdom), Helen McAteer (The Psoriasis Association, Northampton, United Kingdom), John McKenna (Leicester Royal Infirmary, Leicester, United Kingdom), Freya Meynell (Guy's and St Thomas' NHS Foundation Trust), Nick Levell (Norfolk and Norwich University Hospital, Norwich, United Kingdom), Prakash Patel (Guy's and St Thomas' NHS Foundation Trust), Angela Pushparajah (Guy's and St Thomas' NHS Foundation Trust), Catriona Sinclair (Mid and South Essex NHS Foundation Trust, Southend-on-Sea, United Kingdom), Rachel Wachsmuth (Royal Devon and Exeter NHS Foundation Trust, Exeter, United Kingdom), Rosemary Wilson (Guy's and St Thomas' NHS Foundation Trust). A total of 95 affected individuals were whole-exome sequenced as part of a previous study (Vergnano et al., 2020Vergnano M. Mockenhaupt M. Benzian-Olsson N. Paulmann M. Grys K. Mahil S.K. et al.Loss-of-function myeloperoxidase mutations are associated with increased neutrophil counts and pustular skin disease.Am J Hum Genet. 2020; 107 ([published correction appears in Am J Hum Genet 2021;108:757]): 539-543Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). The same reagents and computational pipeline were then used to generate variant profiles for a further 117 patients. Briefly, libraries were prepared with Agilent SureSelect Human All Exome kit and run on an Illumina HiSeq instrument (Illumina Inc, San Diego, CA). Reads were aligned to the hg19 genome using Novoalign (Novocraft Technologies, Petaling Jaya, Malaysia), and variants were called with SAMtools (Li et al., 2009Li H. Handsaker B. Wysoker A. Fennell T. Ruan J. Homer N. et al.The Sequence Alignment/Map format and SAMtools.Bioinformatics. 2009; 25: 2078-2079Crossref PubMed Scopus (35491) Google Scholar) and annotated with ANNOVAR (Wang et al., 2010Wang K. Li M. Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data.Nucleic Acids Res. 2010; 38: e164Crossref PubMed Scopus (8848) Google Scholar). A total of 24 additional palmoplantar pustulosis cases were screened by Sanger sequencing using the primers in Supplementary Table S4. The rare CARD14 alleles detected in palmoplantar pustulosis cases and gnomAD controls were analyzed using the same approach. Briefly, the impact of missense variants was assessed with Combined Annotation Dependent Depletion (CADD) (Rentzsch et al., 2019Rentzsch P. Witten D. Cooper G.M. Shendure J. Kircher M. CADD: predicting the deleteriousness of variants throughout the human genome.Nucleic Acids Res. 2019; 47: D886-D894Crossref PubMed Scopus (1751) Google Scholar), MutationTaster (Schwarz et al., 2010Schwarz J.M. Rödelsperger C. Schuelke M. Seelow D. MutationTaster evaluates disease-causing potential of sequence alterations.Nat Methods. 2010; 7: 575-576Crossref PubMed Scopus (2243) Google Scholar), and PROVEAN (Choi and Chan, 2015Choi Y. Chan A.P. PROVEAN web server: a tool to predict the functional effect of amino acid substitutions and indels.Bioinformatics. 2015; 31: 2745-2747Crossref PubMed Scopus (1703) Google Scholar). Given that the latter program can only be used for the analysis of coding changes, splicing variants were assessed using CADD, MutationTaster, and Spliceman (Lim and Fairbrother, 2012Lim K.H. Fairbrother W.G. Spliceman--a computational web server that predicts sequence variations in pre-mRNA splicing.Bioinformatics. 2012; 28: 1031-1032Crossref PubMed Scopus (51) Google Scholar). Missense and splice site variants that were classified as damaging by at least two predictors were considered potentially pathogenic. Frameshift and nonsense variants were automatically considered potentially pathogenic. A systematic literature review was performed by interrogating the PubMed database with the terms (CARD14 or CARMA2) and (variants or mutations or GWAS or genome-wide linkage). The cut-off date was October 31, 2021. Duplicate articles, conference abstracts, reviews, irrelevant studies, and papers that were not written in English were removed. The rare variants (minor allele frequency < 1%) described in the remaining studies were classified as pathogenic if they were predicted to be damaging by at least two algorithms and met one of the following criteria: described in at least two case reports, segregating with inflammatory skin disease in pedigrees, inherited de novo. Mutant constructs were generated using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA), and primers were designed using Agilent's QuikChange Primer Design tool (https://www.agilent.com/store/primerDesignProgram.jsp) (Supplementary Table S5). All constructs were validated by sequencing the entire CARD14 coding region, pCMV promoter, bovine growth hormone polyadenylation site, and the FLAG sequence. Human embryonic kidney 293 cells were cultured in DMEM supplemented with 2 mM L-Glutamine, 50 U/ml of penicillin, and 50 μg/ml of streptomycin (all from Life Technologies, Carlsbad, CA) and 10% fetal calf serum (LabTech, Heathfield, United Kingdom). Lipofectamine 2000 (Life Technologies) was used to cotransfect cells with the FLAG‒CARD14 constructs and FLAG‒TPP1 (kindly provided by Tracey Mitchell, King's College London, London, United Kingdom). Pellets were harvested after 48 hours. Cell pellets were incubated with nondenaturing lysis buffer (50 mM Tris-hydrogen chloride [pH 7.4], 50 mM sodium chloride, 10% glycerol, 5 mM EDTA, 1% NP-40) and then centrifuged. The supernatant containing the soluble protein fraction was frozen, and the pellet with the insoluble proteins was resuspended in denaturing cell extraction buffer (Thermo Fisher Scientific, Waltham, MA). The two fractions were analyzed by western blotting using a mouse anti-FLAG antibody (Sigma-Aldrich, St. Louis, MO) at 1:3,000 dilution. Autoradiography films were analyzed with ImageJ (National Institutes of Health, Bethesda, MD) (Schneider et al., 2012Schneider C.A. Rasband W.S. Eliceiri K.W. NIH Image to ImageJ: 25 years of image analysis.Nat Methods. 2012; 9: 671-675Crossref PubMed Scopus (39767) Google Scholar) to measure FLAG‒CARD14/FLAG‒TPP1 ratios. Counts of rare and damaging CARD14 alleles were compared in cases vs. controls using Fisher's exact test. Densitometry results were analyzed with a t-test or one-way ANOVA followed by Dunnett's post-test, as appropriate. P < 0.05 was deemed statistically significant.Supplementary Figure S2Distribution of CARD14 missense alleles associated with inflammatory skin disease. The diagram shows the localization of the CARD14 mutations validated through the systematic literature review and the rare variants associated with PPP. The D176H allele is shown in brackets because its frequency exceeds 1% in Asian populations. GUK, guanylate kinase; PPP, palmoplantar pustulosis.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Table S1Patient DemographicsDemographicObservationsSex (%)169 females (79.2%); 43 males (20.8%)Median age of onset (IQR)46 (36‒55)Median PPPASI (IQR)9.6 (3.5‒16.2)Concurrent plaque psoriasis, n (%)67 (31.6%)Current/former smokers, n (%)181 (76.4%)Abbreviations: IQR, interquartile range; PPASI, palmoplantar pustulosis area and severity index. Open table in a new tab Supplementary Table S2Characteristics of the 12 Individuals Harboring CARD14 MutationsDemographicObservationsSex (%)11 females (91.6%); 1 male (8.4%)Median age of onset (IQR)48 (35.5‒56.5)Median PPPASI (IQR)10.3 (2.2‒18)Concurrent plaque psoriasis, n (%)4 (33.3%)Current/former smokers, n (%)7 (58.3%)Abbreviations: IQR, interquartile range; PPASI, palmoplantar pustulosis area and severity index. Open table in a new tab Supplementary Table S3Damaging CARD14 Alleles Associated with Inflammatory Skin DiseaseChangeReference(s)p.Gly117SerAmmar et al., 2016Ammar M. Jordan C.T. Cao L. Lim E. Bouchlaka Souissi C. Jrad A. et al.CARD14 alterations in Tunisian patients with psoriasis and further characterization in European cohorts.Br J Dermatol. 2016; 174: 330-337Crossref PubMed Scopus (33) Google Scholar; Craiglow et al., 2018Craiglow B.G. Boyden L.M. Hu R. Virtanen M. Su J. Rodriguez G. et al.CARD14-associated papulosquamous eruption: a spectrum including features of psoriasis and pityriasis rubra pilaris.J Am Acad Dermatol. 2018; 79: 487-494Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar; Eskin-Schwartz et al., 2016Eskin-Schwartz M. Basel-Vanagaite L. David M. Lagovsky I. Ben-Amitai D. Smirin-Yosef P. et al.Intra-familial variation in clinical phenotype of CARD14-related psoriasis.Acta Derm Venereol. 2016; 96: 885-887Crossref PubMed Scopus (12) Google Scholar; Jordan et al., 2012Jordan C.T. Cao L. Roberson E.D. Pierson K.C. Yang C.F. Joyce C.E. et al.PSORS2 is due to mutations in CARD14.Am J Hum Genet. 2012; 90: 784-795Abstract Full Text Full Text PDF PubMed Scopus (319) Google Scholar; Mössner et al., 2017Mössner R. Wilsmann-Theis D. Oji V. Gkogkolou P. Löhr S. Schulz P. et al.The genetic basis for most patients with pustular skin disease remains elusive.Britsh J Dermatol. 2017; 178: 740-748Crossref Scopus (79) Google Scholar; Takeichi et al., 2017bTakeichi T. Sugiura K. Nomura T. Sakamoto T. Ogawa Y. Oiso N. et al.Pityriasis rubra pilaris Type V as an autoinflammatory disease by CARD14 mutations.JAMA Dermatol. 2017; 153: 66-70Crossref PubMed Scopus (57) Google Scholarc.349+1G>AFuchs-Telem et al., 2012Fuchs-Telem D. Sarig O. van Steensel M.A. Isakov O. Israeli S. Nousbeck J. et al.Familial pityriasis rubra pilaris is caused by mutations in CARD14.Am J Hum Genet. 2012; 91: 163-170Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar; Takeichi et al., 2017aTakeichi T. Kobayashi A. Ogawa E. Okuno Y. Kataoka S. Kono M. et al.Autosomal dominant familial generalized pustular psoriasis caused by a CARD14 mutation.Br J Dermatol. 2017; 177: e133-e135Crossref PubMed Scopus (25) Google Scholarc.349+5G>AJordan et al., 2012Jordan C.T. Cao L. Roberson E.D. Pierson K.C. Yang C.F. Joyce C.E. et al.PSORS2 is due to mutations in CARD14.Am J Hum Genet. 2012; 90: 784-795Abstract Full Text Full Text PDF PubMed Scopus (319) Google Scholarp.Met119ArgCraiglow et al., 2018Craiglow B.G. Boyden L.M. Hu R. Virtanen M. Su J. Rodriguez G. et al.CARD14-associated papulosquamous eruption: a spectrum including features of psoriasis and pityriasis rubra pilaris.J Am Acad Dermatol. 2018; 79: 487-494Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar; Lwin et al., 2018Lwin S.M. Hsu C.K. Liu L. Huang H.Y. Levell N.J. McGrath J.A. Beneficial effect of ustekinumab in familial pityriasis rubra pilaris with a new missense mutation in CARD14.Br J Dermatol. 2018; 178: 969-972Crossref PubMed Scopus (33) Google Scholarp.Met119ThrCraiglow et al., 2018Craiglow B.G. Boyden L.M. Hu R. Virtanen M. Su J. Rodriguez G. et al.CARD14-associated papulosquamous eruption: a spectrum including features of psoriasis and pityriasis rubra pilaris.J Am Acad Dermatol. 2018; 79: 487-494Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar; Frare et al., 2021Frare C.P. Blumstein A.J. Paller A.S. Pieretti L. Choate K.A. Bowcock A.M. et al.CARD14-associated papulosquamous eruption (CAPE) in pediatric patients: three additional cases and review of the literature.Pediatr Dermatol. 2021; 38: 1237-1242Crossref PubMed Scopus (11) Google Scholarp.Leu124ProCraiglow et al., 2018Craiglow B.G. Boyden L.M. Hu R. Virtanen M. Su J. Rodriguez G. et al.CARD14-associated papulosquamous eruption: a spectrum including features of psoriasis and pityriasis rubra pilaris.J Am Acad Dermatol. 2018; 79: 487-494Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar; Eytan et al., 2014Eytan O. Sarig O. Sprecher E. van Steensel M.A. Clinical response to ustekinumab in familial pityriasis rubra pilaris caused by a novel mutation in CARD14.Br J Dermatol. 2014; 171: 420-422Crossref PubMed Scopus (58) Google Scholar; Spoerri et al., 2018Spoerri I. Herms S. Eytan O. Sarig O. Heinimann K. Sprecher E. et al.Immune-regulatory genes as possible modifiers of familial pityriasis rubra pilaris - lessons from a family with PRP and psoriasis.J Eur Acad Dermatol Venereol. 2018; 32: e389-e392Crossref PubMed Scopus (4) Google Scholarp.Cys127SerCraiglow et al., 2018Craiglow B.G. Boyden L.M. Hu R. Virtanen M. Su J. Rodriguez G. et al.CARD14-associated papulosquamous eruption: a spectrum including features of psoriasis and pityriasis rubra pilaris.J Am Acad Dermatol. 2018; 79: 487-494Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar; Takeichi et al., 2017bTakeichi T. Sugiura K. Nomura T. Sakamoto T. Ogawa Y. Oiso N. et al.Pityriasis rubra pilaris Type V as an autoinflammatory disease by CARD14 mutations.JAMA Dermatol. 2017; 153: 66-70Crossref PubMed Scopus (57) Google Scholarp.Gln136LeuTakeichi et al., 2017bTakeichi T. Sugiura K. Nomura T. Sakamoto T. Ogawa Y. Oiso N. et al.Pityriasis rubra pilaris Type V as an autoinflammatory disease by CARD14 mutations.JAMA Dermatol. 2017; 153: 66-70Crossref PubMed Scopus (57) Google Scholarp.Glu138LysHas et al., 2016Has C. Schwieger-Briel A. Schlipf N. Hausser I. Chmel N. Rösler B. et al.Target-sequence capture and high throughput sequencing identify a de novo CARD14 mutation in an infant with erythrodermic pityriasis rubra pilaris.Acta Derm Venereol. 2016; 96: 989-990Crossref PubMed Scopus (12) Google Scholarp.Glu138AlaJordan et al., 2012Jordan C.T. Cao L. Roberson E.D. Pierson K.C. Yang C.F. Joyce C.E. et al.PSORS2 is due to mutations in CARD14.Am J Hum Genet. 2012; 90: 784-795Abstract Full Text Full Text PDF PubMed Scopus (319) Google Scholarp.Glu138delFuchs-Telem et al., 2012Fuchs-Telem D. Sarig O. van Steensel M.A. Isakov O. Israeli S. Nousbeck J. et al.Familial pityriasis rubra pilaris is caused by mutations in CARD14.Am J Hum Genet. 2012; 91: 163-170Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholarp.Leu149ArgSigna et al., 2019Signa S. Campione E. Rusmini M. Chiesa S. Grossi A. Omenetti A. et al.Whole exome sequencing approach to childhood onset familial erythrodermic psoriasis unravels a novel mutation of CARD14 requiring unusual high doses of ustekinumab.Pediatr Rheumatol Online J. 2019; 17: 38Crossref PubMed Scopus (19) Google Scholarp.Cys153SerChiramel et al., 2020Chiramel M.J. Sathishkumar D. Edison E.S. George R. Two cases of CARD14-associated papulosquamous eruption from India.Pediatr Dermatol. 2020; 37: 692-694Crossref PubMed Scopus (5) Google Scholarp.Leu156ProFuchs-Telem et al., 2012Fuchs-Telem D. Sarig O. van Steensel M.A. Isakov O. Israeli S. Nousbeck J. et al.Familial pityriasis rubra pilaris is caused by mutations in CARD14.Am J Hum Genet. 2012; 91: 163-170Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholarp.Asp176HisBerki et al., 2015Berki D.M. Liu L. Choon S.E. David Burden A. Griffiths C.E.M. Navarini A.A. et al.Activating CARD14 mutations are associated with generalized pustular psoriasis but rarely account for familial recurrence in psoriasis vulgaris.J Invest Dermatol. 2015; 135: 2964-2970Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar; Mössner et al., 2017Mössner R. Wilsmann-Theis D. Oji V. Gkogkolou P. Löhr S. Schulz P. et al.The genetic basis for most patients with pustular skin disease remains elusive.Britsh J Dermatol. 2017; 178: 740-748Crossref Scopus (79) Google Scholar; Sugiura et al., 2014Sugiura K. Muto M. Akiyama M. CARD14 c.526G>C (p.Asp176His) is a significant risk factor for generalized pustular psoriasis with psoriasis vulgaris in the Japanese cohort.J Invest Dermatol. 2014; 134: 1755-1757Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar; Takeichi et al., 2017bTakeichi T. Sugiura K. Nomura T. Sakamoto T. Ogawa Y. Oiso N. et al.Pityriasis rubra pilaris Type V as an autoinflammatory disease by CARD14 mutations.JAMA Dermatol. 2017; 153: 66-70Crossref PubMed Scopus (57) Google Scholarp.Glu197LysAmmar et al., 2016Ammar M. Jordan C.T. Cao L. Lim E. Bouchlaka Souissi C. Jrad A. et al.CARD14 alterations in Tunisian patients with psoriasis and further characterization in European cohorts.Br J Dermatol. 2016; 174: 330-337Crossref PubMed Scopus (33) Google Scholarp.Ile593ThrPeled et al., 2019Peled A. Sarig O. Sun G. Samuelov L. Ma C.A. Zhang Y. et al.Loss-of-function mutations in caspase recruitment domain-containing protein 14 (CARD14) are associated with a severe variant of atopic dermatitis.J Allergy Clin Immunol. 2019; 143: 173-181.e10Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholarp.Ser602LeuAmmar et al., 2016Ammar M. Jordan C.T. Cao L. Lim E. Bouchlaka Souissi C. Jrad A. et al.CARD14 alterations in Tunisian patients with psoriasis and further characterization in European cohorts.Br J Dermatol. 2016; 174: 330-337Crossref PubMed Scopus (33) Google Scholar Open table in a new tab Supplementary Table S4CARD14 Sequencing PrimersTargetPrimer NameSequence (5′‒3′)Annealing (°C)Exon 4CARD14_Exon4FATGGCCACTGGAATGCTTC63CARD14_Exon4RCAGGACGAGAAGAGACCCCExon 5CARD14_Exon5FACCCAGCAGAACCCAGAAA64CARD14_Exon5RAAGGGGGAGTAGGGCAAATExon 6CARD14_Exon6FTGCTCACCTGCTCACCTAC66CARD14_Exon6RAAGGAGTTCCAGGGAGATGGExon 7CARD14_Exon7FTTCAGTCTCGAGGCAGGAAG63CARD14_Exon7RAACCACCTGTCAGAAACCCCExon 8CARD14_Exon8FAAGACTGCATCCGTCCACA63CARD14_Exon8RAATTATGTGAGCTCGGCGTGExon 9CARD14_Exon9FAGAACTGTCTCCCTCCCTC66CARD14_Exon9RTGTGGACCGAGGAAAGAGACExon 10CARD14_Exon10FCACTGCACATGTGAACACGA63CARD14_Exon10RTCGCTCATCACAGTGACACTExon 11CARD14_Exon11FCTGGAAGCTGACGAGAGGAA63CARD14_Exon11RCGTACCAACCTCTTCCCTGTExons 12 + 13CARD14_Exon12_13FTGTGTCCTTCTTTCCCCTCC66CARD14_Exon12_13RTATCTGCCCTTTCCCTGGAGExons 14 + 15CARD14_Exon14_15FAGATCTGTGAAGAAGGGGCT66CARD14_Exon14_15RTGAAGTCTGCCTGGGTCACExon 16 + 17CARD14_Exon16_17FTGCAGGCAGTGGTCCTAC63CARD14_Exon16_17RCGCCCACCCTCTATTGCTExon 18CARD14_Exon18FAAAGCTCTGGAGACTGGCAT63CARD14_Exon18RTTTGAAGGGGTGCAGAGGAGExon 19CARD14_Exon19FACACACCTCAGGCTGTTCTC63CARD14_Exon19RCCCAGCCCCATGATTCTTGAExon 20 + 21CARD14_Exon20_21FTGGAATTCTAGGTGCTGGGG64CARD14_Exon20_21RGGTCGGTCCCTGTACCTTTAExon 22CARD14_Exon22FAAATTCAGCTCTGCCCAGCTCC63CARD14_Exon22RTCCCAAAGTTGTGCGGAAACExon 23CARD14_Exon23FTGTCATCACTACCCTAGCCA63CARD14_Exon23RGCCTCATGTGCCAAGGAG Open table in a new tab Supplementary Table S5Mutagenesis PrimersVariantPrimers (5′‒3′)p.Arg182CysCACAGCCGCATGAAGTGTGAGGTTAGCGCACGTGCGCTAACCTCACACTTCATGCGGCTGTGp.Ser384PheCTGCGGAGGAAGTCCTTCTCCACCAGGCCTGGTGGAGAAGGACTTCCTCCGCAGp.Thr591MetGAAGATGCCCATGAGGTTCCCGCCGATGATCATCGGCGGGAACCTCATGGGCATCTTCThe p.Asp176His mutagenesis primers were described by Berki et al., 2015Berki D.M. Liu L. Choon S.E. David Burden A. Griffiths C.E.M. Navarini A.A. et al.Activating CARD14 mutations are associated with generalized pustular psoriasis but rarely account for familial recurrence in psoriasis vulgaris.J Invest Dermatol. 2015; 135: 2964-2970Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar. Open table in a new tab Abbreviations: IQR, interquartile range; PPASI, palmoplantar pustulosis area and severity index. Abbreviations: IQR, interquartile range; PPASI, palmoplantar pustulosis area and severity index. The p.Asp176His mutagenesis primers were described by Berki et al., 2015Berki D.M. Liu L. Choon S.E. David Burden A. Griffiths C.E.M. Navarini A.A. et al.Activating CARD14 mutations are associated with generalized pustular psoriasis but rarely account for familial recurrence in psoriasis vulgaris.J Invest Dermatol. 2015; 135: 2964-2970Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar.