Cistrome and Epicistrome Features Shape the Regulatory DNA Landscape

(Cell 165, 1280–1292; May 19, 2016) In the above article, we described an approach, termed “DNA Affinity Purification Sequencing” (DAP-seq) to probe specific transcription factor binding interactions with genomic DNA. The method relies on isolation of fragments of genomic DNA followed by ligation of specific adaptor oligonucleotides, which are later used to amplify the TF-bound fragments. In the Supplemental Experimental Procedures, the Adaptor B sequence shown was missing the 5′ phosphate modification required for ligation, and the Illumina TruSeq Index primer was shown as the reverse complement of the sequence used in the analyses. The correct sequences are: Adaptor B: 5′ P-GATCGGAAGAGCACACGTCTG and TruSeq Index primer: 5′-CAAGCAGAAGACGGCATACGAGAT-NNNNNN GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC (where the NNNNNN represents the six-base-pair sequence index used for sample identification). These changes, which have been made to the article online, will enable amplification of genomic DNA fragments in the system as described. We apologize for any inconvenience this error may have caused. Cistrome and Epicistrome Features Shape the Regulatory DNA LandscapeO’Malley et al.CellMay 19, 2016In BriefA new method for pinpointing transcription factor binding sites in the Arabidopsis genome and their responsiveness to DNA methylation demonstrates the impact of tissue-specific DNA chemical modifications on gene regulation, potentially for any organism. Full-Text PDF Open Archive