Structural Features of MicroRNA (miRNA) Precursors and Their Relevance to miRNA Biogenesis and Small Interfering RNA/Short Hairpin RNA Design

We have established the structures of 10 human microRNA (miRNA) precursors using biochemical methods. Eight of these structures turned out to be different from those that were computer-predicted. The differences localized in the terminal loop region and at the opposite side of the precursor hairpin stem. We have analyzed the features of these structures from the perspectives of miRNA biogenesis and active strand selection. We demonstrated the different thermodynamic stability profiles for pre-miRNA hairpins harboring miRNAs at their 5′- and 3′-sides and discussed their functional implications. Our results showed that miRNA prediction based on predicted precursor structures may give ambiguous results, and the success rate is significantly higher for the experimentally determined structures. On the other hand, the differences between the predicted and experimentally determined structures did not affect the stability of termini produced through “conceptual dicing.” This result confirms the value of thermodynamic analysis based on mfold as a predictor of strand section by RNAi-induced silencing complex (RISC). We have established the structures of 10 human microRNA (miRNA) precursors using biochemical methods. Eight of these structures turned out to be different from those that were computer-predicted. The differences localized in the terminal loop region and at the opposite side of the precursor hairpin stem. We have analyzed the features of these structures from the perspectives of miRNA biogenesis and active strand selection. We demonstrated the different thermodynamic stability profiles for pre-miRNA hairpins harboring miRNAs at their 5′- and 3′-sides and discussed their functional implications. Our results showed that miRNA prediction based on predicted precursor structures may give ambiguous results, and the success rate is significantly higher for the experimentally determined structures. On the other hand, the differences between the predicted and experimentally determined structures did not affect the stability of termini produced through “conceptual dicing.” This result confirms the value of thermodynamic analysis based on mfold as a predictor of strand section by RNAi-induced silencing complex (RISC). MicroRNAs (miRNAs) 1The abbreviations used are: miRNA, microRNA; nt, nucleotide; RNAi, RNA interference; siRNA, small interfering RNA; shRNA, short-hairpin RNA. are a large family of short 20–25-nt single-stranded noncoding RNAs recently identified in many eukaryotes from nematode to human (1Lau N.C. Lim L.P. Weinstein E.G. Bartel D.P. Science. 2001; 294: 858-862Crossref PubMed Scopus (2697) Google Scholar, 2Lee R. Ambros V. Science. 2001; 294: 862-864Crossref PubMed Scopus (2339) Google Scholar, 3Lagos-Quintana M. Rauhut R. Lendlecker W. Tuschl T. Science. 2001; 294: 853-858Crossref PubMed Scopus (3975) Google Scholar, 4Mourelatos Z. Destie J. Paushkin S. Sharma A. Charroux B. Abel L. Rappsilber J. Mann M. Dreyfuss G. Genes Dev. 2002; 16: 720-728Crossref PubMed Scopus (876) Google Scholar). The best known founding members of this family are lin-4 (5Lee R.C. Feinbaum R.L. Ambros V. Cell. 1993; 75: 843-854Abstract Full Text PDF PubMed Scopus (9830) Google Scholar) and let-7 (6Slack F.J. Basson M. Liu Z. Ambros V. Horvitz H.R. Ruvkun G. Mol. Cell. 2000; 5: 659-669Abstract Full Text Full Text PDF PubMed Scopus (604) Google Scholar) of Caenorhabditis elegans that trigger the translational inhibition of their target mRNAs by partial base-pairing within the 3′-untranslated region. According to the results of recent surveys performed using the experimental (3Lagos-Quintana M. Rauhut R. Lendlecker W. Tuschl T. Science. 2001; 294: 853-858Crossref PubMed Scopus (3975) Google Scholar, 7Lagos-Quintana M. Rauhut R. Meyer J. Borkhardt A. Tuschl T. RNA (N. Y.). 2003; 9: 175-179Crossref PubMed Scopus (737) Google Scholar) and bioinformatic approaches (8Lim L.P. Glasner M.E. Yekta S. Burge C.B. Bartel D.P. Science. 2003; 299: 1540Crossref PubMed Scopus (1025) Google Scholar, 9Lai E.C. Tomancak P. Williams R.W. Rubin G.M. Genome Biol. 2003; 4: R42.1-R42.20Crossref Google Scholar), the miRNA genes may contribute ∼1% to the total gene content of the investigated organisms making this regulatory mechanism more common than previously thought. Primary transcripts of the miRNA genes, pri-microRNAs, are processed in the nucleus to pre-microRNAs by the ribonuclease Drosha (10Lee Y. Ahn C. Han J. Chol H. Kim J. Yim J. Lee J. Provost P. Radmark O. Kim S. Kim V.N. Nature. 2003; 425: 415-419Crossref PubMed Scopus (4026) Google Scholar) and exported from the nucleus by Exportin-5 (11Lund E. Guttinger S. Calado A. Dahlberg J.E. Kutay U. Science. 2003; 303: 95-98Crossref PubMed Scopus (2089) Google Scholar). The 60–90-nt miRNA precursors form the stem and loop structures, and the cytoplasmic ribonuclease class III enzyme Dicer (12Hutvágner G. Zamore P.D. Science. 2002; 297: 2056-2060Crossref PubMed Scopus (1649) Google Scholar, 13Knight S.W. Bass B.L. Science. 2001; 293: 2269-2271Crossref PubMed Scopus (695) Google Scholar, 14Bernstein E. Caudy A.A. Hammond S.M. Hannon G.J. Nature. 2001; 409: 363-366Crossref PubMed Scopus (3819) Google Scholar) excises miRNAs from the pre-miRNA hairpin stem. Dicer, either alone or with the help of Drosha, cleaves both strands of the precursor to form a double-stranded microRNA/microRNA* duplex (10Lee Y. Ahn C. Han J. Chol H. Kim J. Yim J. Lee J. Provost P. Radmark O. Kim S. Kim V.N. Nature. 2003; 425: 415-419Crossref PubMed Scopus (4026) Google Scholar, 15Hutvágner G. McLachlan J. Pasquinelli A.E. Balint E. Tuschl T. Zamore P.D. Science. 2001; 293: 834-838Crossref PubMed Scopus (2190) Google Scholar, 16Reinhart B.J. Bartel D.P. Science. 2002; 297: 1831Crossref PubMed Scopus (415) Google Scholar) but only this strand accumulates which enters the RNAi-induced silencing complex (RISC) (17Khvorova A. Reynolds A. Jayasena S.D. Cell. 2003; 115: 209-216Abstract Full Text Full Text PDF PubMed Scopus (2033) Google Scholar, 18Schwarz D.S. Hutvágner G. Du T. Xu Z. Aronin N. Zamore P.D. Cell. 2003; 115: 199-208Abstract Full Text Full Text PDF PubMed Scopus (2215) Google Scholar). Based on the mechanism of the precursor hairpin processing and the similarities between the miRNA and RNAi pathways, active siRNA duplexes could be predicted with a high success rate (17Khvorova A. Reynolds A. Jayasena S.D. Cell. 2003; 115: 209-216Abstract Full Text Full Text PDF PubMed Scopus (2033) Google Scholar, 18Schwarz D.S. Hutvágner G. Du T. Xu Z. Aronin N. Zamore P.D. Cell. 2003; 115: 199-208Abstract Full Text Full Text PDF PubMed Scopus (2215) Google Scholar). It appears that designing siRNAs so that their properties resemble those of putative double-stranded miRNA intermediates, produces highly effective siRNAs. The strand whose 5′-end is less tightly paired to its complement is selected to enter into the RNAi-induced silencing complex, whereas the opposite strand is degraded. Thus, the structure of miRNA precursors and their short lived processing intermediates turned out to be the key for successful siRNA design (17Khvorova A. Reynolds A. Jayasena S.D. Cell. 2003; 115: 209-216Abstract Full Text Full Text PDF PubMed Scopus (2033) Google Scholar, 18Schwarz D.S. Hutvágner G. Du T. Xu Z. Aronin N. Zamore P.D. Cell. 2003; 115: 199-208Abstract Full Text Full Text PDF PubMed Scopus (2215) Google Scholar). In this light it was surprising that no experimental verification of microRNA precursor structures, which were all computer-predicted, was done thus far. The miRNA precursors are predicted to form irregular hairpin structures containing various mismatches, internal loops and bulges (19Griffiths-Jones S. Nucleic Acids Res. 2004; 32: D109-D111Crossref PubMed Google Scholar), and several structures with little difference in the lowest free energy are often proposed by a structure prediction program (20Zuker M. Nucleic Acids Res. 2003; 31: 3406-3415Crossref PubMed Scopus (10412) Google Scholar). To find the structure that is most favorable in solution we implemented experimental methods. Chemical and enzymatic probing of nucleotide accessibility (21Ehresmann C. Baudin F. Mougel M. Romby P. Ebel J.P. Ehresmann B. Nucleic Acids Res. 1987; 15: 9109-9128Crossref PubMed Scopus (661) Google Scholar, 22Giege R. Helm M. Florentz C. Soll D. Nishimura S. Moore P.B. RNA. Elsevier Sciences Ltd., Oxford2001: 71-89Crossref Google Scholar) was chosen to obtain reliable structure information rapidly, taking advantage of the distinct specificity of different chemical reagents and nucleases. The experimentally determined secondary structures were searched for their properties relevant to the postulated mechanism of miRNA biogenesis (23Bartel D. Cell. 2004; 116: 281-297Abstract Full Text Full Text PDF PubMed Scopus (29863) Google Scholar, 24Carmell M.A. Hannon G.J. Nat. Struct. Mol. Biol. 2004; 3: 214-218Crossref Scopus (312) Google Scholar). We used for this purpose an improved version of the recently described thermodynamic structure profiling method (17Khvorova A. Reynolds A. Jayasena S.D. Cell. 2003; 115: 209-216Abstract Full Text Full Text PDF PubMed Scopus (2033) Google Scholar). Other than the specific thermodynamic and reactivity signatures of individual precursors, characteristic profiles have been revealed corresponding to the groups of precursors containing miRNAs either at the 5′- or 3′-side of their hairpin stem. Preparation of DNA Templates for in Vitro Transcription—DNA oligomers were obtained by chemical synthesis and purified by polyacrylamide gel electrophoresis. Each oligomer contains a DNA sequence complementary to the microRNA precursor sequence and to the sequence of T7 RNA polymerase promoter at the 3′-end (see Table I). The double-stranded templates for in vitro transcription were prepared using the primer extension procedure (200 pmol of template oligomer and 1 mmol of T7GG primer 5′-taatacgactcactatagg, 200 μm each dNTPs, standard PCR buffer, and 0.5 units of TaqDNA polymerase/100 μl of reaction mixture) in two-step PCR, 50 cycles at 94 °C for 15 s and 45 °C for 15 s, and were purified using centrifugal filter devices Microcon YM30 (Millipore).Table IOligodeoxynucleotides used for transcript synthesisNameDNA oligomer sequence (5′—3′)aT7 promoter sequence underlined for in vitro transcriptionbResidues added to the DNA templates to enable efficient in vitro transcription. These extra nucleotides when transcribed constitute the only differences between the proposed sequences of natural pre-miRNAs (3) and these investigated in this studypre-let-7cgctccaaggaaagctagaaggttgtacagttaactcccagggtgtaactctaaaccatacaacctactacctcaacccggatgcctatagtgagtcgtattapre-let-7f-2ggctgggaaagacagtagactgtatagttatctccaagatggggtatgaccctaaaactatacaatctactacctcatcccacagcctatagtgagtcgtattapre-miR-15aggccttgtatttttgaggcagcacaatatggcctgcaccttttcaaaatccacaaaccattatgtggtcctactttactccaaggcctatagtgagtcgtattapre-miR-16—1ggtcaaccttacttcagcagcagagttaatactggagataattttagaatcttaacgccaatatttacgtgctgctaaggcactgctgacctatagtgagtcgtattapre-miR-17ggtcaccataatgctacaagtgccttcactgcagtagatgcacatatcactacctgcactgtaagcactttgacattattctgacctatagtgagtcgtattapre-miR-18aattgccagaaggagcacttagggcagtaatgctaatctacttcactatctgcactagatgcaccttagaacaaaaacctatagtgagtcgtattapre-miR-19aggcaggccaccatcagttttgcatagatttcgacaactagattcttcttgtactgcaactatgcaaaactaacagaggactgcctatagtgagtcgtattapre-miR-25ggccggcactgtcagaccgagacaagtgcaatgcccagggcagcgtccagcaattgcccaagtctccgcctctcaacactggcctatagtgagtcgtattapre-miR-29aggataaccgatttcagatggtgctagaaaattatatacactccgaacaccaaaagaaatcagtcatcctatagtgagtcgtattapre-miR-30aggcagctgcaaacatccgactgaaagcccatctgtggcttcacagcttccagtcgaggatgtttacagtcgcctatagtgagtcgtattaa T7 promoter sequence underlinedb Residues added to the DNA templates to enable efficient in vitro transcription. These extra nucleotides when transcribed constitute the only differences between the proposed sequences of natural pre-miRNAs (3Lagos-Quintana M. Rauhut R. Lendlecker W. Tuschl T. Science. 2001; 294: 853-858Crossref PubMed Scopus (3975) Google Scholar) and these investigated in this study Open table in a new tab Transcription in Vitro—The pre-microRNAs used in this study were prepared by in vitro transcription with T7 RNA polymerase. The transcription reaction carried out in a 50-μl volume contained 20 pmol of DNA template, 50 μm rNTPs, 3.3 mm guanosine, 40 units of ribonuclease inhibitor RNase Out (Invitrogen), and 400 units of T7 RNA polymerase (Ambion). The guanosine was added to the reaction mixture to place it at the 5′-end in a high proportion of transcripts, thus making the 5′-end dephosphorylation step unnecessary. The transcription reaction was carried out at 37 °C for 1 h, and transcripts were purified in denaturing 10% polyacrylamide gel, excised, eluted from the gel (0.3 m sodium acetate, pH 5.2, 0.5 mm EDTA, and 0.1% SDS), and precipitated. All transcripts were 5′-end-labeled with T4 polynucleotide kinase and [γ-32P]ATP (4500 Ci/mmol; ICN). The labeled RNAs were gel-purified and stored at -70 °C in water before use. Nuclease Digestions and Metal Ions Induced Cleavages of RNA—Prior to structure probing, the 32P-labeled transcripts were subjected to a denaturation and renaturation procedure, in a solution containing 12 mm Tris-HCl, pH 7.2, 48 mm NaCl, and 1.2 mm MgCl2 by heating the sample at 90 °C for 1 min followed by a slow cooling to 37 °C. Limited digestion of RNA was performed at 37 °C in a solution containing 10 mm Tris-HCl, pH 7.2, 40 mm NaCl, and 1 mm MgCl2 (0.5 mm ZnCl2 was also present in reactions with nuclease S1) obtained by mixing 8 μl of the RNA solution described above (∼5 pmol of RNA) with 2 μl of a probe at different concentrations. Final concentrations of probes in the reactions were as follows: S1 nuclease, 0.3, 0.6, and 1.2 units/μl; T1 ribonuclease, 0.1, 0.2, and 0.3 units/μl; T2 ribonuclease, 0.03, 0.04, and 0.05 units/μl; V1 ribonuclease, 0.03, 0.04, and 0.05 units/μl; Pb2+ ions, 0.1, 0.2, and 0.4 mm; Mn2+ ions, 1.5, 5, and 7.5 mm; Mg2+ ions, 1.5, 5, and 7.5 mm; Ca2+ ions, 1.5, 5, and 7.5 mm. Reactions with Mn2+, Mg2+, and Ca2+ ions were performed at 37 °C in a solution containing 10 mm Tris-HCl, pH 8.5, or 9.0 and 40 mm NaCl. The reactions with nucleases and lead ions were stopped after 10 min, reactions with Mn2+ after 2 h, and reactions with Mg2+ and Ca2+ after 16 h by adding an equal volume of a stop solution containing 7.5 m urea, 20 mm EDTA, and dyes. The alkaline hydrolysis ladder was generated by the incubation of the labeled RNA in formamide containing 0.5 mm MgCl2 at 100 °C for 10 min. The partial digestion of RNAs (∼5 pmol) with T1 ribonuclease was performed under semidenaturing conditions (10 mm sodium citrate, pH 5.0, 3.5 m urea) for 12 min at 55 °C with 0.2 units/μl of the enzyme. Electrophoresis was in 15% polyacrylamide gel under denaturing conditions at 1500 V and was followed by autoradiography at -80 °C with an intensifying screen. The products of the structure-probing reactions were also visualized and analyzed by phosphorimaging (Typhoon, Molecular Dynamics). To minimize the possible contributions from secondary cleavages, the cuts generated in the transcripts that underwent the reaction in less than 10% were considered in the structure analysis. Electrophoresis in Nondenaturing Conditions—The homogeneity of the RNA structure was analyzed for all investigated transcripts by the electrophoresis of radiolabeled samples in 10% nondenaturing polyacrylamide gel (dimensions 150 × 140 × 1 mm) (acrylamide/bisacrylamide, 29/1) buffered with 10 mm Tris-HCl, pH 7.2, and containing 40 mm NaCl and 1 mm MgCl2 at a controlled temperature of 37 °C. Prior to gel electrophoresis, the 32P-labeled transcripts (∼5 pmol each) were subjected to a denaturation and renaturation procedure as described in the preceding section but in a solution containing 10 mm Tris-HCl, pH 7.2, 40 mm NaCl and 1 mm MgCl2 and mixed with an equal volume of the same solution containing 7% sucrose and dyes. Electrophoresis was performed at 100 V with buffer circulation at 2 liter/h. RNA Secondary Structure Prediction—RNA secondary structure prediction was performed using the mfold program version 3.1 (20Zuker M. Nucleic Acids Res. 2003; 31: 3406-3415Crossref PubMed Scopus (10412) Google Scholar). This program is designed to determine the optimal and suboptimal secondary structures of RNA and to count free energy contributions for various secondary structure motifs. RNA Thermodynamic Profiling—The internal hairpin stability values were calculated according to the nearest neighbor method using thermodynamic parameters determined at 37 °C, for all stacking free energy values (expressed in kcal/mole), taking into consideration all the different destabilizing elements such as internal loops and bulges, using the 3.1 version of the mfold program (20Zuker M. Nucleic Acids Res. 2003; 31: 3406-3415Crossref PubMed Scopus (10412) Google Scholar). Two different kinds of RNAs, pre-miRNAs and duplex intermediates, were analyzed using procedures that differed in some aspects as follows. The analysis of precursor structures was performed using trinucleotide subsequences to define their central position. To adjust the stability profiles to the corresponding secondary structures the ΔG values characteristic for the base pair closing the single-stranded region were assigned also for other structural elements of this region (supplemental Fig. 5A). On the other hand, in the analysis of duplex intermediates, instead of using the scanning window, the thermodynamic parameters were calculated for each interacting base pair and each structure-destabilizing element (supplemental Fig. 5B). Selected miRNA Precursors and Probes Used for Structure Analysis—We intended to experimentally analyze the secondary structure of representative human pre-miRNAs. We selected the following 10 pre-miRNAs of which five, pre-let-7c, pre-let-7f-2, pre-miR-15a, pre-miR-16-1, and pre-miR-18, have the mature miRNA at the 5′-side, four, pre-miR-19a, pre-miR-25, pre-miR-29a, and pre-miR-30a, have the mature miRNA on the 3′-side, and one, pre-miR-17, on both sides. When these RNAs were subjected to structure prediction using the mfold program (20Zuker M. Nucleic Acids Res. 2003; 31: 3406-3415Crossref PubMed Scopus (10412) Google Scholar) the resulting lowest energy precursor hairpins differed in their terminal loop size as well as in the number, size, and location of various internal loops and/or bulges. For half of the analyzed precursors two or more alternative structures were proposed within the 10% range of the suboptimality parameter. For the experimental analysis, we chemically synthesized DNA templates (Table I) that allowed the in vitro transcription of pre-miRNAs. The extra nucleotides added to the precursor sequences to allow their efficient in vitro transcription did not change their mfold predicted structures. The transcripts were 5′-end-labeled and gel-purified. Their structural homogeneity was confirmed by electrophoresis in nondenaturing polyacrylamide gel (supplemental Fig. 1A). Next, we subjected the RNAs to structure probing as shown in supplemental Fig. 1, B and C for the pre-let-7f-2 and pre-miR-29a. The chemical probes used to analyze each transcript were Mg2+ (25Marciniec T. Ciesiolka J. Wrzesinski J. Krzyzosiak W.J. FEBS Lett. 1989; 243: 293-298Crossref PubMed Scopus (39) Google Scholar), Mn2+ (26Wrzesinski J. Michalowski D. Ciesiolka J. Krzyzosiak W.J. FEBS Lett. 1995; 374: 62-68Crossref PubMed Scopus (26) Google Scholar), Ca2+ (27Streicher B. Westhof E. Schroeder R. EMBO J. 1996; 15: 2556-2564Crossref PubMed Scopus (54) Google Scholar), and Pb2+ ions (28Ciesiolka J. Michalowski D. Wrzesinski J. Krajewski J. Krzyzosiak W.J. J. Mol. Biol. 1998; 275: 211-220Crossref PubMed Scopus (92) Google Scholar, 29Gornicki P. Baudin F. Romby P. Wiewiorowski M. Krzyzosiak W. Ebel J.P. Ehresmann C. Ehresmann B. J. Biomol. Struct. Dyn. 1989; 6: 971-984Crossref PubMed Scopus (89) Google Scholar, 30Krzyzosiak W.J. Marciniec T. Wiewiorowski M. Romby P. Ebel J.P. Giege R. Biochemistry. 1988; 27: 5771-5777Crossref PubMed Scopus (102) Google Scholar) and nucleases included the single-strand-specific S1, T1, and T2 (31Knapp G. Methods Enzymol. 1989; 180: 192-212Crossref PubMed Scopus (174) Google Scholar) and double-strand-specific V1 (32Favorova O.O. Fasiolo F. Keith G. Vassilenko S.K. Ebel J.P. Biochemistry. 1981; 20: 1006-1011Crossref PubMed Scopus (68) Google Scholar, 33Lockard R.E. Kumar A. Nucleic Acids Res. 1981; 9: 5125-5140Crossref PubMed Scopus (100) Google Scholar). The metal ions differentiate between rigid and flexible regions of the RNA structure. The former are resistant and latter susceptible to cleavage in agreement with the mechanism proposed for phosphodiester bond cleavage by lead (34Brown R.S. Hingerty B.E. Dewan J.C. Klug A. Nature. 1983; 303: 543-546Crossref PubMed Scopus (208) Google Scholar, 35Brown R.S. Dewan J.C. Klug A. Biochemistry. 1985; 24: 4785-4801Crossref PubMed Scopus (258) Google Scholar). In brief, the reaction begins with the activation of the ribose 2′-OH group by the metal ion hydroxide, and the attack of the 2′-O-nucleophile on the adjacent phosphorus atom, which requires conformational flexibility of the sugar phosphate backbone. The Majority of Experimentally Determined Structures of miRNA Precursors Differ from Those Predicted—When we subjected the labeled transcripts to single-strand-specific probes the centrally located nucleotides of all miRNA precursor sequences were found to be the most reactive regions. This suggested hairpin structures in which the regions of enhanced reactivity corresponded to their terminal loops. The Mg2+ and Ca2+ ions turned out to be the probes distinguishing most precisely between paired and unpaired nucleotides in the stem regions of the precursor hairpins (Fig. 1). The reactive phosphodiester bonds mapped by these two probes often overlap each other, and the Ca2+ ions cut the great majority of internucleotide bonds present in numerous bulges and internal loops. For example, among eight stem-structure-distorting motifs proposed to exist in pre-miR-18, as many as seven are recognized by the Ca2+ ions and five by Mg2+ ions. The only motif undetected by Ca2+ ions in this structure is the single nucleotide A-bulge. This pattern of reactivity is in line with the flexible geometry and variable coordination number of the Ca2+ aquacation in solution (36Pyle A.M. Sigel A. Sigel H. Metal ions in Biological Systems. Marcel Dekker, Inc., Basel, Switzerland1996: 479-520Google Scholar). The sizes of terminal loops of the precursor hairpins are well mapped by the single-strand-specific nucleases (Fig. 2 and supplemental Fig. 2). On the other hand, the small internal loops, bulges, and mismatches are poorly mapped by the enzymatic probes. For example, neither the symmetrical 6-nucleotide nor asymmetrical 3-nucleotide internal loops present in pre-miR29a were cleaved by the nucleases. Among the detected motifs are bulges mapped by the T2 ribonuclease in pre-let-7c, miR-15a, miR-16-1, miR-19a, and miR-30a precursors. Their detection is in agreement with the earlier observations that nucleases recognize well larger single-stranded regions. The failure of nucleases, and in some cases also metal ions, to detect small symmetrical internal loops and mismatches when they are surrounded by stable double-helical regions may indicate that these motifs form noncanonical base pairs (37Kierzek R. Burkard M.E. Turner D.H. Biochemistry. 1999; 38: 14214-14223Crossref PubMed Scopus (146) Google Scholar, 38Leontis N.B. Westhof E. RNA (N. Y.). 2001; 7: 499-512Crossref PubMed Scopus (755) Google Scholar), which do not distort the duplex structure significantly. The advantageous feature of metal ions in RNA structure probing is that their hydrates are much smaller than nucleases, penetrate folded RNAs easier, and reveal more details of the analyzed structures (39Michalowski D. Wrzesinski J. Krzyzosiak W.J. Biochemistry. 1996; 35: 10727-10734Crossref PubMed Scopus (29) Google Scholar). Altogether, aside from hairpin terminal loops, 47 other structure motifs such as internal loops, bulges, and mismatches other than G-U wobble pairs are proposed to occur in the experimentally determined secondary structures of 10 analyzed precursors (Figs. 1 and 2, supplemental Figs. 2 and 3). The 12 of the 13 internal loops are mapped by the Ca2+ ions at both strands (Fig. 1). The Mg2+ ions failed to detect a single internal loop, and the presence of two of such loops was revealed by cleavages generated in one strand only. All bulges larger than a single-nucleotide were mapped by both types of metal ions and two of the eight single-nucleotide bulges escaped detection by both ions. Of the 14 mismatches present in the proposed precursor structures, as many as 13 were detected by the Ca2+ ions and 10 by Mg2+ (Fig. 1). In sum, 44 of the 47 distinct structure motifs were detected by both metal ions. This compares favorably with only 12 of the 47 such motifs detected by nucleases. Importantly, in 8 of the 10 investigated transcripts the experimentally determined structures of miRNA precursors turned out to be different from those predicted to be the most favorable. In seven transcripts (pre-let-7c, pre-let-7f-2, pre-miR-15a, pre-miR-16-1, pre-miR-18, pre-miR-25, and pre-miR-29a) the hairpin terminal loop regions were different (Fig. 2 and supplemental Fig. 2). The differences included the size and localization of terminal loops and accompanying changes in the neighboring stem regions. For example, in the pre-miR-18 the nucleotides G30-C54 form a 5-nucleotide terminal loop, a 4-nucleotide symmetric internal loop, and a 3-nucleotide bulge at the 3′-side of the stem. In the predicted structure there is a 6-nucleotide terminal loop, a 6-nucleotide asymmetric internal loop, and a 1-nucleotide bulge at the 5′-side of the stem. It is also worth noting, that in the case of eight precursors none of the experimentally determined structures were computer-predicted within the 10% range of the suboptimality parameter. Thus, only the structures of pre-miR-29a and pre-miR-30a predicted by mfold to be the most stable were confirmed by the experiment. Duplex Portions of MicroRNA Precursors Show Polarity in Their Reactivity and Thermodynamic Stability—Having established the secondary structures of the investigated precursors we intended to gain an insight into the features of their helical portions. We applied for this purpose the ribonuclease V1, which cleavages were expected to be sensitive to distortions in helical conformation. We also used the Pb2+ and Mn2+ ions, which are more reactive than Ca2+ and Mg2+ and in addition the single-stranded regions should also cleave the flexible portions of duplexes. Finally, we used the thermodynamic profiling of the precursor structures to show how the structure probing and structure stability data corresponded to each other. The ribonuclease V1 cleavages occurred only at the 5′-side of the hairpin stem in 4 of 10 analyzed precursors, pre-let-7c, pre-let-7f-2, pre-miR-29a, and pre-miR-30a. In the remaining six precursors, several much weaker 3′-side cleavages also occurred (not shown). When the sites of V1 cuts were compared with the experimentally determined secondary structures of the precursors, the highly variable patterns emerged (Fig. 3 and supplemental Fig. 4). The number of reactive bonds was generally higher than that of the resistant ones, and several very strong cuts were typically observed in each transcript. Both duplexes composed of standard W-C base pairs and G-U wobble pairs only (e.g. in pre-miR-17 and pre-mir-15a) as well as duplexes containing some internal mismatches (e.g. in pre-let-7c and pre-miR-25) were digested. This may suggest that the distortions of helical structures in the latter are rather modest. The strongest V1 cuts frequently occur in investigated transcripts at the sites of increased sequence regularity such as mono-(GGG, UUU, UUUU, AAA), di-, or trinucleotide repeats (UGUG, UAUA, CACA, CUCU, AAUAAU), which are likely to be also the sites of more regular structure. The V1-resistant regions, other than the 4–6 internucleotide bonds from the 5′ terminus, typically occur in the neighborhood of duplex structure distortions such as some bulges, internal loops, and the U-C mismatches. With regard to the barely known sequence specificity of ribonuclease V1 it is interesting to note that the enzyme prefers to cleave the phosphodiester bonds at weak A-U, U-A, and wobble U-G pairs. Of the 12 strong cleavages taking place after the A residue, the GC or GU sequences are always located 5′ to the cleavage site. Next, we used the Pb2+ and Mn2+ ions to reveal in which parts of the pre-miRNA stem structures the phosphodiester bonds are more flexible than in others. We wanted to find out how the distribution of reactive regions in duplexes corresponds to the location of miRNA ends when they are still embedded in the precursor hairpin structure? As expected, the Pb2+ and Mn2+ ions mapped also the phosphodiester bonds of several paired nucleotides located in the neighborhood of bulges or internal loops (Fig. 3 and supplemental Fig. 4). In several precursors the region of the miRNA 5′-end is more susceptible to cleavages than that of their 3′-end. For example, in the pre-miR-19a the nucleotides U50-G51 of the miRNA 5′-end are localized in the 3-nt bulge, but a longer stretch of nucleotides U49-C54 shows an increased susceptibility to cleavage. On the other hand, the region of the miR-19a 3′-end is poorly cleaved by the Mn2+ and Pb2+ ions. What is noteworthy is that the regions of enhanced reactivity occur also in the central portions of sequences corresponding to the mature miRNAs. Although these regions correlate with the localization