摘要
Background & Aims: In searching for effects of acetaminophen (APAP) on hepatocytes downstream of its metabolism that may participate in hepatotoxicity, we examined the role of stress kinases. Methods: Mouse hepatocytes and C57BL/6 mice were administered a toxic dose of APAP with or without SP600125, a chemical c-jun N-terminal kinase (JNK) inhibitor. JNK activity as reflected in phospho-c-jun levels, serum alanine transaminase (ALT), and liver histology were assessed. Similar experiments were repeated in JNK1 and JNK2 knockout mice and by using antisense oligonucleotide (ASO) to knockdown JNK. Results: Sustained activation of JNK was observed in cultured mouse hepatocytes and in vivo in the liver after APAP treatment. The importance of this pathway was identified by the marked protective effect of SP600125 against APAP toxicity in vitro and in vivo. The specificity of this protective effect was confirmed in vivo by the knockdown of JNK1 and 2 using ASO pretreatment. JNK2 knockout mice and mice treated with JNK2 ASO exhibited partial protection against APAP. One potential target of JNK is Bax translocation, which was enhanced by APAP and blocked by the JNK inhibitor. Protection by the JNK inhibitor persisted in Kupffer cell-depleted mice, whereas there was no protection against CCl4 or concanavalin A toxicity. Conclusions: This work suggests that JNK acts downstream of APAP metabolism to promote hepatotoxicity. The results suggest that JNK2 plays a predominant role, although maximum protection was seen with decrease in both forms of JNK. Background & Aims: In searching for effects of acetaminophen (APAP) on hepatocytes downstream of its metabolism that may participate in hepatotoxicity, we examined the role of stress kinases. Methods: Mouse hepatocytes and C57BL/6 mice were administered a toxic dose of APAP with or without SP600125, a chemical c-jun N-terminal kinase (JNK) inhibitor. JNK activity as reflected in phospho-c-jun levels, serum alanine transaminase (ALT), and liver histology were assessed. Similar experiments were repeated in JNK1 and JNK2 knockout mice and by using antisense oligonucleotide (ASO) to knockdown JNK. Results: Sustained activation of JNK was observed in cultured mouse hepatocytes and in vivo in the liver after APAP treatment. The importance of this pathway was identified by the marked protective effect of SP600125 against APAP toxicity in vitro and in vivo. The specificity of this protective effect was confirmed in vivo by the knockdown of JNK1 and 2 using ASO pretreatment. JNK2 knockout mice and mice treated with JNK2 ASO exhibited partial protection against APAP. One potential target of JNK is Bax translocation, which was enhanced by APAP and blocked by the JNK inhibitor. Protection by the JNK inhibitor persisted in Kupffer cell-depleted mice, whereas there was no protection against CCl4 or concanavalin A toxicity. Conclusions: This work suggests that JNK acts downstream of APAP metabolism to promote hepatotoxicity. The results suggest that JNK2 plays a predominant role, although maximum protection was seen with decrease in both forms of JNK. See editorial on page 314.Acetaminophen (APAP) hepatotoxicity is the most common cause of acute liver failure in the United States.1Lee W.M. Acute liver failure in the United States.Semin Liver Dis. 2003; 23: 217-226Crossref PubMed Scopus (318) Google Scholar Toxicity is dose related and reproducible in animal models. APAP is the most extensively studied hepatotoxin. However, after more than 30 years of intensive research, uncertainties and controversies concerning the mechanism of injury caused by APAP continue to exist.One fact concerning the toxic mechanism of APAP is indisputable, namely that as a prerequisite for toxicity, a small proportion of an APAP dose is converted by cytochrome p-450 (CYP) metabolism to N-acetyl-p-benzoquinoneimine (NAPQI), which preferentially binds irreversibly to the thiol of reduced glutathione (GSH); when sufficient NAPQI is generated to deplete severely the hepatic GSH in both cytosol and mitochondria of hepatocytes, cell death ensues.2Nelson S.D. Bruschi S.A. Mechanisms of acetaminophen-induced liver disease.in: Kaplowitz N. Deleve L.D. Drug-induced liver disease. Marcel Dekker, New York2003: 287-325Google Scholar At the point when GSH is depleted, unopposed covalent binding of NAPQI to protein thiols occurs. Controversy exists as to whether covalent binding to critical protein targets or oxidative stress as a consequence of mitochondrial GSH depletion then promotes injury. Furthermore, it has remained uncertain whether these chemical consequences of NAPQI formation are directly lethal or trigger intracellular metabolic processes (eg, signaling pathways) that recruit intrinsic cellular machinery that promote apoptosis or necrosis. While searching for the downstream effects of profound GSH depletion as a consequence of APAP or other GSH-depleting agents, we previously observed that the stress kinase c-jun N-terminal kinase (JNK) underwent sustained activation in primary mouse hepatocytes exposed to APAP and a chemical JNK inhibitor (SP600125) significantly protected hepatocytes against APAP-induced necrosis.3Matsumaru K. Ji C. Kaplowitz N. Mechanisms for sensitization to TNF-induced apoptosis by acute glutathione depletion in murine hepatocytes.Hepatology. 2003; 37: 1425-1434Crossref PubMed Scopus (135) Google Scholar In view of the controversies surrounding the mechanisms of APAP toxicity and the relevance of cell culture models, the present studies were designed to explore the role of JNK in APAP toxicity and the effect of inhibiting JNK using mainly the in vivo mouse model.Materials and MethodsMaterialsJNK inhibitor SP600125, p38 inhibitor SB203580, and ERK inhibitor PD98059 were purchased from Calbiochem (San Diego, CA). Antisense oligonucleotides (ASO) targeting mouse JNK1 (Isis 104492), JNK2 (Isis 101759), and a chemical control oligonucleotide (Isis 141923) were synthesized as 20 nucleotide, uniform phosphorothioate chimeric oligonucleotides and purified as previously described.4Baker B. Lot S. Condon T. Cheng-Flournoy S. Lesnik E. Sasmor H. Bennett C. 2′-O-(2-methoxy)ethyl-modified anti-cellular adhesion molecule 1 (ICAM-1) oligonucleotides selectively increase the ICAM-1 mRNA level and inhibit formation of the ICAM-1 translation initiation complex in human umbilical vein endothelial cells.J Biol Chem. 1997; 272: 11994-12000Crossref PubMed Scopus (310) Google Scholar The oligonucleotides used in these studies were chimeric oligonucleotides containing 5 nuclease resistant 2′-O-methoxyethylribose (MOE)-modified phosphorothioate residues on the 5′ and 3′ ends, flanking a 2′-deoxyribonucleotide/phosphorothioate region that supports RNase H-based cleavage of the targeted messenger RNA (mRNA). The sequences of the mouse JNK1 ASO and JNK2 ASO are 5′- TGTTGTCACGTTTACTTCTG -3′ and 5′- GCTCAGTGGACATGGATGAG -3′, respectively. The chemistry control oligonucleotide sequence is, 5′-CCTTCCCTGAAGGTTCCTCC-3′. Anti-phospho-c-Jun, JNK, and cytochrome oxidase IV (COX IV) antisera were purchased from Cell Signaling (Beverly, MA). Anti-Bax and actin antisera were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). APAP (Sigma Chemical Co, St. Louis, MO) was dissolved using 10% dimethyl sulfoxide (DMSO) in phosphate-buffered saline (PBS). SP600125 was dissolved using 5% DMSO in PBS. 14C-labelled APAP (5.4 mCi/mmol) was also purchased from Sigma Chemical Co. All other chemicals were purchased from standard commercial sources.AnimalsMale C57 BL/6 and C3H/He mice (4–6 weeks of age) were obtained from Harlan Bioproducts for Science Inc (Indianapolis, IN). JNK1 knockout (k/o), JNK2 k/o, tumor necrosis factor (TNF)-R1 k/o, and wild-type (C57 BL/6) mice (4–6 weeks of age) were obtained from Jackson Laboratories (Bar Harbor, ME). The animals were housed in a temperature-controlled room and were allowed to acclimatize for a minimum of 3 days prior to use in experiments. They were maintained on a commercial pellet diet ad libitum. The animals were fasted overnight for food, but not water, prior to experiments. All the treatments were administered intraperitoneally (IP), except for concanavalin A (Con A), which was given intravenously (IV). For ASO experiments, the animals were given 50 mg/kg in sterile saline IP twice per week for 2 weeks prior to APAP administration. The last dose of ASO was given 1 day prior to APAP administration. At the time of killing, small pieces of liver tissue were quickly dissected and homogenized in lysis buffer (30 mmol/L Tris, pH 7.5, 1% Nonidet P-40, 150 mmol/L sodium chloride, and cocktail of proteinase inhibitors) at 4°C. After centrifugation at 15,000 rpm at 4°C for 20 minutes, the supernatants were collected for GSH or Western blot analysis. Blood was obtained after mice were anesthetized at the indicated time periods and serum alanine transaminase (ALT) was measured at the USC Pathology Reference Laboratory. All animals received care according to methods approved under institutional guidelines for the care and use of laboratory animals in research.Cell Isolation and CultureHepatocytes were isolated and cultured as previously described.3Matsumaru K. Ji C. Kaplowitz N. Mechanisms for sensitization to TNF-induced apoptosis by acute glutathione depletion in murine hepatocytes.Hepatology. 2003; 37: 1425-1434Crossref PubMed Scopus (135) Google Scholar Four hours after plating, the culture medium was replaced with serum-free medium containing 100 U/mL penicillin and 0.1 mg/mL streptomycin. For GSH and Western Blot analysis, the cells were rinsed in PBS. After removing PBS, lysis buffer was added, and the cells were incubated on ice for 5 minutes. After sonication, the cells were centrifuged at 14,000g for 10 minutes at 4°C. The supernatants were then collected, and protein concentration was measured with the Bradford assay (Bio-Rad Laboratories, Hercules, CA).Necrosis and Apoptosis AnalysisAnalysis for necrosis and apoptosis in hepatocytes was done as previously described.3Matsumaru K. Ji C. Kaplowitz N. Mechanisms for sensitization to TNF-induced apoptosis by acute glutathione depletion in murine hepatocytes.Hepatology. 2003; 37: 1425-1434Crossref PubMed Scopus (135) Google Scholar, 5Nagai H. Matsumaru K. Feng G. Kaplowitz N. Reduced glutathione depletion causes necrosis and sensitization to tumor necrosis factor-α-induced apoptosis in cultured mouse hepatocytes.Hepatology. 2002; 36: 55-64Crossref PubMed Scopus (173) Google Scholar Briefly, 15 hours after treatments, the cells were stained with 8 μg/mL Hoechst 32258 and 20 minutes later with 1 μmol/L Sytox Green (Molecular Probes, Eugene, OR). The cells were then viewed using fluorescent microscope. Quantitation of necrotic and apoptotic cells was performed by counting more than 500 cells per well.GSH MeasurementGSH was measured in cells and liver homogenates by the DTNB-glutathione reductase recycling assay (Tietze’s method).6Tietze F. Enzymic method for quantitative determination of nanogram amounts of total and oxidized glutathione; applications to mammalian blood and other tissues.Anal Biochem. 1969; 27: 502-522Crossref PubMed Scopus (5502) Google Scholar For mitochondrial GSH, mitochondria was isolated from liver homogenates by the Percoll gradient method.7Fernández-Checa J.C. García-Ruiz C. Ookhtens M. Kaplowitz N. Impaired uptake of GSH by hepatic mitochondria from chronic ethanol-fed rats Tracer kinetic studies in vitro and in vivo and susceptibility to oxidant stress.J Clin Invest. 1991; 87: 397-405Crossref PubMed Scopus (219) Google Scholar Briefly, liver homogenates were layered on top of 4 different concentrations of Percoll buffer. After centrifugation at 19,000 rpm for 1 minute, mitochondria were isolated within 42% Percoll buffer. Mitochondrial GSH was corrected for cross contamination, which was measured using lactate dehydrogenase and succinic acid dehydrogenase.Covalent BindingAPAP covalent binding was measured as described before.8Jollow D.J. Mitchell J.R. Potter W.Z. Davis D.J. Gillete J.R. Brodie B.B. Acetaminophen-induced hepatic necrosis. II Role of covalent binding in vivo.J Pharmacol Exp Ther. 1973; 187: 195-202PubMed Google Scholar Briefly, the cells were treated with [14C] APAP (5.4 mCi/mmol) and 5 mmol/L APAP for 1 hour and subsequently were homogenized using lysis buffer. After adding ice-cold 0.9 mol/L trichloroacetic acid (TCA), the cells were centrifuged at 8000g at 4°C for 10 minutes. The pellets were washed 3 times with ice-cold 0.6 mol/L TCA and also with ice-cold 80% methanol. The pellets were then dissolved in 1 mol/L NaOH at 60°C for 1 hour. After mixing with 1.5% acetic acid and scintillant solution, radioactivity was measured.Western Blot AnalysisAliquots of liver extracts were fractionated by electrophoresis on 12% SDS polyacrylamide gel. Subsequently, proteins were transferred to nitrocellulose membrane, and blots were blocked in 5% nonfat milk dissolved in Tris-buffered saline (TBS) with Tween-20. The blots were then incubated with the desired primary and secondary antibodies. Finally, the proteins were detected by Luminol ECL reagent (Santa Cruz Biotechnology, Santa Cruz, CA).Isolation of Mitochondria Using Differential CentrifugationLiver mitochondria for Western blot analysis were isolated by differential centrifugation as previously described.9Han D. Williams E. Cadenas E. Mitochondrial respiratory chain-dependent generation of superoxide anion and its release into the intermembrane space.Biochem J. 2001; 353: 411-416Crossref PubMed Scopus (468) Google Scholar Livers from mice were excised, washed with 0.25 mol/L sucrose, and homogenized in H medium (210 mmol/L mannitol/70 mol/L sucrose/2 mmol/L Hepes/0.05% bovine serum albumin) with protease and phosphatase inhibitor. The homogenate was subsequently centrifuged at 800g for 8 minutes, the pellet removed, and the centrifugation process repeated. The resulting supernatant was centrifuged at 8000g for 10 minutes, washed with H medium, and centrifugation repeated.HistopathologyH&E-stained liver sections were examined under low-power (×100) microscopy, and necrosis was graded using a system previously described10Wood M. Berman M.L. Harbison R.D. Hoyle P. Phythyon J.M. Wood A.J.J. Halothane-induced hepatic necrosis in triiodothyronine-pretreated rats.Anesthesiology. 1980; 52: 470-476Crossref PubMed Scopus (45) Google Scholar: 0, no lesion present; ½, individual necrotic cells seen at the first cell layer adjacent to the central vein and hyaline degeneration present; 1, necrotic cells extending 2 or 3 cell layers from the central veins; 2, necrotic cells extending 3 to 6 cell layers from the central veins but limited in peripheral distribution; 3, the same as 2+ but with necrosis extending from one central vein to another; 4, more severe than 3+, with extensive centrilobular necrosis throughout the section. An overall score was computed for each liver based on assessment of 5 of lobules.Depletion of Kupffer Cells and Reverse-Transcriptase Polymerase Chain Reaction for Kupffer Cell MarkersDichloromethylene-bisphosphonate (Cl2MBP)-encapsulated liposomes have been widely used to deplete macrophages/Kupffer cells.11Van Rooijen N. Sanders A. Liposome-mediated depletion of macrophages mechanism of action, preparation of liposomes and applications.J Immunol Methods. 1994; 174: 83-93Crossref PubMed Scopus (1474) Google Scholar, 12Austyn J.M. Gordon S. F4/80, a monoclonal antibody directed specifically against the mouse macrophage.Eur J Immunol. 1981; 11: 805-815Crossref PubMed Scopus (1278) Google Scholar, 13Schumann J. Wolf D. Pahl A. Brune K. Papadopoulos T. van Rooijen N. Tiegs G. Importance of Kupffer cells for T-cell-dependent liver injury in mice.Am J Pathol. 2000; 157: 1671-1683Abstract Full Text Full Text PDF PubMed Scopus (259) Google Scholar Empty liposomes (PBS-liposomes) and Cl2MBP-liposomes were prepared as previously described.11Van Rooijen N. Sanders A. Liposome-mediated depletion of macrophages mechanism of action, preparation of liposomes and applications.J Immunol Methods. 1994; 174: 83-93Crossref PubMed Scopus (1474) Google Scholar For depletion of Kupffer cells, 200 μL of Cl2MBP-liposomes suspension was injected into mice through the tail vein 48 hours before challenge. Control animals received PBS-liposomes intravenously. The depletion of Kupffer cells at 48 hours after Cl2MBP-liposomes injection was confirmed by examining lipopolysaccharide (LPS)-stimulated hepatic TNF-α and CD14 expression, which are indicators of Kupffer cell activation.14Su G.L. Lipopolysaccharides in liver injury molecular mechanisms of Kupffer cell activation.Am J Physiol Gastrointest Liver Physiol. 2002; 283: G256-G265Crossref PubMed Scopus (416) Google Scholar, 15Ji C. Deng Q. Kaplowitz N. Role of TNF-α in ethanol-induced hyperhomocysteinemia and murine alcoholic liver injury.Hepatology. 2004; 40: 442-451Crossref PubMed Scopus (122) Google Scholar One hour after mice received IP injection of a nonlethal dose of LPS (1 mg/kg), liver tissues were harvested and total RNA was extracted. Subsequently, hepatic TNF-α and CD14 mRNA expression were analyzed by RT-PCR. The specific primers for PCR are designed from published sequences: TNF-α, sense 5′-ATGAGCACAGAAAGCATGATC-3′, antisense 5′-TACAGGCTTGTCACTCGAATT-3′; CD14, sense 5′-CTGCAGCAGTGGCTAAAGCCTGGACTCA-3′, antisense 5′-CCACTTGGGGCAGCTCATCTGGGCTAG-3′; β-actin, sense 5′-TGTGATGGTGGGAATGGGTCAG-3′, antisense 5′-TTTGATGTCACGCACGATTTCC-3′.LPS increased hepatic mRNA expression for TNF-α and CD14 in PBS-liposome-treated mice as expected. However, pretreatment with Cl2MBP-liposomes almost completely inhibited LPS-induced TNF-α and CD14 expressions in the liver (supplemental Figure 1) (see supplemental material online at www.gastrojournal.org).Statistical AnalysisStatistical analyses were performed using the Student t test for unpaired data or ANOVA. P value less than .05 was considered significant.ResultsEffect of JNK Inhibitor, SP600125, on APAP-Induced Toxicity in Murine HepatocytesFirst, we confirmed the previous finding that 1-hour pretreatment with JNK inhibitor (20 μmol/L) provided significant protection (>50%) against 5 mmol/L APAP-induced necrosis (not shown). Equimolar concentrations of inhibitors of MAP kinases, p38 and Erk, did not provide significant protection against APAP-induced necrosis determined after 15 hours (not shown). Protection by the JNK inhibitor was not accompanied by a change in the extent of maximum GSH depletion Figure 1 (Figure 1A) or [14C] covalent binding (Figure 1B) observed 3 hours and 1 hour after addition of APAP, respectively, which are the times of maximal GSH depletion and covalent binding. These results indicate that the JNK inhibitor did not alter the production of the toxic APAP metabolite NAPQI. Furthermore, to prove that inhibition of JNK did not affect the rate of resynthesis of GSH, we assessed the effect of adding buthionine sulfoximine (BSO), an inhibitor of GSH synthesis. BSO markedly potentiated the toxicity of APAP (2.5 mmol/L), but the JNK inhibitor continued to exhibit a significant protective effect (Figure 2), indicating that protection is not dependent on GSH synthesis.Figure 2Effect of JNK inhibitor (SP600125) on APAP and BSO induced necrosis. Primary mouse hepatocytes were treated with 2.5 mmol/L APAP or 1 mmol/L BSO or combination of 2.5 mmol/L APAP and 1 mmol/L of BSO with and without 20 μmol/L JNK inhibitor pretreatment. Cell death was assessed at 15 hours. Results are mean ± SD for 3 experiments. *P < .05 vs APAP + BSO group.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Effect of JNK inhibitor, SP600125, in APAP-Induced Liver Injury in C57BL/6 MiceTo study the effect of the JNK inhibitor on APAP toxicity in vivo, we first confirmed that APAP increased hepatic JNK activity and that the JNK inhibitor (10 mg/kg) blocked JNK activity in vivo as reflected in phospho-c-Jun levels (Figure 3A). Phospho-c-jun was barely detectable in untreated mice, increased gradually at 2 and 4 hours, peaking at 6 hours, and remained increased at 8 hours. Thus, sustained JNK activation occurs in response to APAP (Figure 3B and 3C).Figure 3Effect of JNK inhibitor (SP600125) on APAP induced JNK activity and toxicity in vivo in C57BL/6 mice. (A) Western blot of phospho-c-Jun. Phospho-c-Jun was measured at 4 hours after APAP treatment in the absence and presence of JNK inhibitor pretreatment. (B) Phospho-c-Jun time course. Phospho-c-Jun levels were measured at different time points after APAP treatment with densitometric comparison for 3 different experiments shown in C. *P < .05 vs other groups. (D) Serum ALT. Mice received 800 mg/kg APAP alone (n = 22, 23% mortality) or were pretreated 1 hour before APAP treatment with 10 mg/kg JNK inhibitor (n = 10, 0% mortality), 20 mg/kg p38 inhibitor (n = 6, 33.3% mortality), or 20 mg/kg Erk inhibitor (n = 6, 16.7% mortality), respectively. The surviving mice were then killed at 24 hours after APAP treatment, and serum ALT was determined. Results are mean ± SD. *P < .05 vs all other groups. (E) Survival. Using 1000 mg/kg APAP, survival was determined at 24 and 48 hours after APAP treatment in the presence or absence of pretreatment with JNK inhibitor. Each group had 6 mice. (F) Liver histology. Representative H&E-stained sections of liver of mice that received 800 mg/kg APAP. The mice were killed at 24 hours after APAP treatment either pretreated 1 hour with vehicle or SP600125.View Large Image Figure ViewerDownload Hi-res image Download (PPT)In C57BL/6 mice given 800 mg/kg APAP, serum ALT levels (U/L) began to increase at 6 hours (230.5 ± 207.9 U/L, mean ± SD) and peaked at around 24 hours (mean of 3611.1 ± 1712.0 U/L) with mortality rate of 22.7% at 24 hours (n = 22). When the dose was increased to 1000 mg/kg, the mortality rate increased to 50% at 24 hours and 66.6% at 48 hours with mean ALT levels of the surviving mice of 5500 ± 259.7 U/L (n = 6) at 24 hours. One hour pretreatment with 10 mg/kg JNK inhibitor provided remarkable protection with only slight elevation of serum ALT, 111.7 ± 75.7 U/L (n = 10) (Figure 3D). Similar to hepatocyte experiments, p38 and Erk inhibitors did not provide significant protection (Figure 3D). Using 1000 mg/kg APAP, JNK inhibitor completely prevented the lethal effect (Figure 3E). Moreover, the mice that received 1000 mg/kg APAP and JNK inhibitor pretreatment had mean ALT values of 142.4 ± 62.5 U/L (n = 6). Histology of livers from the mice that received APAP alone had 2.8 ± 0.4 grade for centrilobular necrosis, and livers from the mice that received JNK inhibitor pretreatment were virtually normal (grade 0.1 ± 0.2) (Figure 3F).Similar to the findings in murine hepatocytes, pretreatment with the JNK inhibitor did not provide protection against maximum total liver GSH depletion, which occurred between 3 to 6 hours after APAP injection (Figure 4A). However, the rate of fall of total liver GSH showed a nonsignificant trend to be somewhat slower in the early phase so that total liver GSH levels at 1 hour were higher (70% depletion) with the JNK inhibitor than in controls (90% depletion). The significance of this is uncertain, but the extent of maximal depletion up to 6 hours was not altered. However, pretreatment with the JNK inhibitor did not alter mitochondrial GSH depletion at 1 and 3 hours after APAP injection (Figure 4B).Figure 4Effect of JNK inhibitor on APAP induced glutathione (GSH) depletion in mice. (A) Total GSH. Total liver GSH (percentage of control) was measured at 1 (n = 27), 3 (n = 6), and 6 (n = 16) hours after 800 mg/kg APAP injection in C57BL/6 mice in the absence or presence of 1 hour JNK inhibitor pretreatment. Mean total liver GSH for control was 7.12 ± 2.49 μmol/g liver. Results are mean ± SD. (B) Mitochondrial GSH. Mitochondrial GSH (percentage of control) was measured at 1 and 3 hours after 800 mg/kg APAP injection in the absence or presence of 1 hour JNK inhibitor pretreatment. Mean mitochondrial GSH for control was 0.24 ± 0.4 μmol/g liver. Results are mean ± SD. Each group had 3 mice for each time point.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Because of the concern that the JNK inhibitor may be modifying the early events in APAP metabolism, we examined the effect of delaying the treatment until after maximal GSH depletion. Indeed, the JNK inhibitor continued to provide striking protection, even if given up to 6 hours after APAP injection (Figure 5). When given after 8 hours, the JNK inhibitor treatment no longer showed significant protection.Figure 5Effect of timing of JNK inhibitor administration on APAP hepatotoxicity. C57BL/6 mice received 800 mg/kg APAP at time 0 and JNK inhibitor (10 mg/kg) from −6 to +8 hours. For each time point, 3 or more mice were used, and serum ALT was measured at 24 hours after APAP injection. Results are mean ± SD. At right, ALT values for APAP + vehicle at 8 hours are depicted (n = 12). Mortality was only seen in the 8-hour delayed treatment group (42% with JNK inhibitor and 50% with vehicle).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Effect of JNK Inhibitor, SP600125, in APAP-Induced Liver Injury in C3H/He MiceBecause mouse strain differences in susceptibility to APAP have been reported, the experiments were repeated with C3H/He mice. These mice were more susceptible to APAP hepatotoxicity than C57BL/6 mice. The mortality rate at 24 hours in 19 mice treated with 800 mg/kg APAP was 80% and in 6 mice treated with 600 mg/kg APAP was 50% with mean serum ALT levels of 12,060 ± 4049.1 U/L in the survivors. One hour pretreatment with JNK inhibitor completely abrogated mortality at 800 mg/kg dose (n = 8), and levels of ALT were normal, 48.5 ± 20 U/L. These findings were also confirmed histologically because a 3.8 ± 0.4 grade for centrilobular necrosis was noted in livers from surviving mice that did not receive JNK inhibitor, whereas livers from mice that received JNK inhibitor were nearly normal, grade 0.1 ± 0.2 (not shown).Effect of APAP in JNK1 k/o and JNK2 k/o MiceAlthough SP600125 is selective in inhibition of JNK among MAP kinase, it has been reported that it can inhibit other protein kinases.16Bain J. Mclauchlan H. Elliot M. Cohen P. The specificities of protein kinase inhibitors an update.Biochem J. 2003; 371: 199-204Crossref PubMed Scopus (1230) Google Scholar Therefore, we attempted to confirm that the protection against APAP hepatotoxicity was specifically due to JNK inhibition. JNK1 and 2 double knockout is embryonic lethal,17Kuan C.Y. Yang D.D. Samanta Roy D.R. Davis R.J. Rakic P. Flavell R.A. The Jnk1 and Jnk2 protein kinases are required for regional specific apoptosis during early brain development.Neuron. 1999; 22: 667-676Abstract Full Text Full Text PDF PubMed Scopus (761) Google Scholar so we examined the effect of APAP in JNK1 or JNK2 k/o on C57BL/6 background mice. Using 800 mg/kg, there was no difference in toxicity (serum ALT) in the JNK1 k/o versus wild-type (C57BL/6) mice (Figure 6A). In JNK2 k/o mice, mean ALT levels were significantly lower than in wild-type mice, but the protection was not as impressive as with the JNK inhibitor SP600125. Although histology of livers from JNK1 knockout mice demonstrated a 3.8 ± 0.4 grade for centrilobular necrosis, histology of livers from the JNK2 knockout mice showed variation, from ½ to 4 centrilobular necrosis with the average grade of 2.0 ± 1.8 (Figure 6B and C). Thus, the knockout mice studies hinted at a role for JNK2, but the possible compensatory effects of JNK1 in JNK2 knockout mice might explain why the results with SP600125 were more impressive.Figure 6Effect of APAP on JNK1 k/o and JNK2 k/o mice. (A) Serum ALT. All mice received 800 mg/kg APAP (wild-type/C57BL/6: 8 mice; JNK1 k/o: 6 mice; JNK2 k/o: 6 mice). Mice were killed at 24 hours, and serum ALT was measured. *P < .05 vs wild type. (B and C) Histology in JNK k/o mice. Representative H&E-stained sections of liver of JNK1 k/o mouse (B) and JNK2 k/o mouse (C) 24 hours after 800 mg/kg APAP.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Assessment of JNK1 and JNK2 ASO on APAP-Induced Liver InjuryAn antisense strategy to knockdown both JNK1 and/or JNK2 was therefore employed. Using the regimen of twice weekly injection of combined JNK1 + 2 antisense preparations, we found a marked decrease in JNK on Western blotting of liver (Figure 7A and 7B). We treated C57BL/6 mice with both JNK1 and JNK2 ASO or control oligonucleotide for 2 weeks and then administered APAP. The combined JNK1 and JNK2 ASO treated mice were remarkably resistant to toxicity from 800 mg/kg APAP, with mean ALT of 46 ± 24.1 U/L at 24 hours (Figure 7C) and exhibited no mortality even at a dose of 1000 mg/kg (Figure 7D). Maximal GSH depletion at 3 hours after 800 mg/kg APAP was the same in control and JNK1 + 2 knockdown (Figure 7E).Figure 7Effect of JNK1 and JNK2 antisense oligonucleotides (ASO) on APAP induced toxicity. (A and B). Western blots of JNK. C57BL/6 mice received