Processive Phosphorylation of p130Cas by Src Depends on SH3-Polyproline Interactions

Many in vivo substrates of Src family tyrosine kinases possess sequences conforming to Src homology 2 and 3 (SH2 and SH3) domain-binding motifs. One such substrate is p130Cas, a protein that is hyperphosphorylated in v-Src transformed cells. Cas contains a substrate domain consisting of 15 potential tyrosine phosphorylation sites, C- and N-terminal polyproline regions fitting the consensus sequence for SH3 domain ligands, and a YDYV motif that binds the Src SH2 domain when phosphorylated. In an effort to understand the mechanisms of processive phosphorylation, we have explored the regions of Cas necessary for interaction with Src using the yeast two-hybrid system. Mutations in the SH2 domain-binding region of Cas or the Src SH2 domain have little effect in Cas-Src complex formation or phosphorylation. However, disruption of the C-terminal polyproline region of Cas completely abolishes interaction between the two proteins and results in impaired phosphorylation of Cas. Kinetic analyses using purified proteins indicated that multisite phosphorylation of Cas by Src follows a processive rather than a distributive mechanism. Furthermore, the kinetic studies show that there are two properties of the polyproline region of Cas that are important in enhancing substrate phosphorylation. First, the C-terminal polyproline serves to activate Src kinases through the process of SH3 domain displacement. Second, this region aids in anchoring the kinase to Cas to facilitate processive phosphorylation of the substrate domain. The two processes combine to ensure phosphorylation of Cas with high efficiency. Many in vivo substrates of Src family tyrosine kinases possess sequences conforming to Src homology 2 and 3 (SH2 and SH3) domain-binding motifs. One such substrate is p130Cas, a protein that is hyperphosphorylated in v-Src transformed cells. Cas contains a substrate domain consisting of 15 potential tyrosine phosphorylation sites, C- and N-terminal polyproline regions fitting the consensus sequence for SH3 domain ligands, and a YDYV motif that binds the Src SH2 domain when phosphorylated. In an effort to understand the mechanisms of processive phosphorylation, we have explored the regions of Cas necessary for interaction with Src using the yeast two-hybrid system. Mutations in the SH2 domain-binding region of Cas or the Src SH2 domain have little effect in Cas-Src complex formation or phosphorylation. However, disruption of the C-terminal polyproline region of Cas completely abolishes interaction between the two proteins and results in impaired phosphorylation of Cas. Kinetic analyses using purified proteins indicated that multisite phosphorylation of Cas by Src follows a processive rather than a distributive mechanism. Furthermore, the kinetic studies show that there are two properties of the polyproline region of Cas that are important in enhancing substrate phosphorylation. First, the C-terminal polyproline serves to activate Src kinases through the process of SH3 domain displacement. Second, this region aids in anchoring the kinase to Cas to facilitate processive phosphorylation of the substrate domain. The two processes combine to ensure phosphorylation of Cas with high efficiency. Src homology viral polyacrylamide gel electrophoresis wild type optical density × 10−3 binding domain Phosphorylation of proteins on tyrosine residues is central to a variety of intracellular signal transduction pathways. The enzymes responsible for this modification, tyrosine kinases, occur as transmembrane receptors or nonreceptor cytoplasmic proteins. The uncontrolled signaling resulting from the deregulation of tyrosine kinase activity has been implicated in the onset and progression of a variety of human malignancies (1Biscardi J.S. Tice D.A. Parsons S.J. Adv. Cancer Res. 1999; 76: 61-119Crossref PubMed Google Scholar). Thus, considerable interest exists in the study of tyrosine kinase substrate selection, regulation of activity, and biological function. In vitro studies using peptide libraries have helped to determine the substrate specificities of several tyrosine kinases (2Songyang Z. Carraway III, K.L. Eck M.J. Harrison S.C. Feldman R.A. Mohammadi M. Schlessinger J. Hubbard S.R. Smith D.P. Eng C. Lorenzo M.J. Poner B.A.J. Mayer B.J. Cantley L.C. Nature. 1995; 373: 536-539Crossref PubMed Scopus (861) Google Scholar, 3Till J.H. Annan R.S. Carr S.A. Miller W.T. J. Biol. Chem. 1994; 269: 7423-7428Abstract Full Text PDF PubMed Google Scholar, 4Wu J. Ma Q.N. Lam K.S. Biochemistry. 1994; 33: 14825-14833Crossref PubMed Scopus (101) Google Scholar). Surprisingly, the catalytic domains of tyrosine kinases possess less rigorous substrate specificity than those of Ser/Thr kinases (2Songyang Z. Carraway III, K.L. Eck M.J. Harrison S.C. Feldman R.A. Mohammadi M. Schlessinger J. Hubbard S.R. Smith D.P. Eng C. Lorenzo M.J. Poner B.A.J. Mayer B.J. Cantley L.C. Nature. 1995; 373: 536-539Crossref PubMed Scopus (861) Google Scholar). However, cytoplasmic tyrosine kinases have an array of accessory domains implicated in protein-protein interactions that can further influence substrate selection. Src family tyrosine kinases are organized into a set of modular domains: unique, SH3,1 SH2, and catalytic. The catalytic domain is responsible for transferring phosphate from ATP onto tyrosine residues of substrate proteins. The noncatalytic SH2, SH3, and unique domains each have multiple roles that are important for the regulation of cellular kinase function. The SH2 and SH3 domains regulate kinase activity by maintaining the catalytic domain in an inactive conformation. In addition, the SH2 and SH3 domains bind to protein substrates and aid in the localization of the kinase to specific subcellular compartments. The fact that many in vivo substrates of nonreceptor tyrosine kinases contain SH2 and/or SH3 domain-binding motifs supports the notion that specificity arises outside the catalytic domain (see Refs. 5Brown M.T. Cooper J.A. Biochim. Biophys. Acta. 1996; 1287: 121-149Crossref PubMed Scopus (1096) Google Scholar and 6Cooper J.A. Howell B. Cell. 1993; 73: 1051-1054Abstract Full Text PDF PubMed Scopus (506) Google Scholar for reviews). The SH2 domain binds phosphotyrosine-containing sequences with high affinity and specificity (7Songyang Z. Shoelson S.E. Chaudhuri M. Gish G. Pawson T. Haser W.G. King F. Roberts T. Ratnofsky S. Lechleider R.J. Neel B.G. Birge R.B. Fajardo J.E. Chou M.M. Hanafusa H. Schaffhausen B. Cantley L.C. Cell. 1993; 72: 767-778Abstract Full Text PDF PubMed Scopus (2462) Google Scholar). One of the first indications of the ability of SH2 domains to modulate tyrosine kinase substrate specificity came from the observation that altering the domain results in impaired transformation efficiency. For example, deletion of the SH2 domain of the tyrosine kinases v-Abl and v-Src causes a loss in the transforming activity with no reduction in kinase activity (5Brown M.T. Cooper J.A. Biochim. Biophys. Acta. 1996; 1287: 121-149Crossref PubMed Scopus (1096) Google Scholar, 8Mayer B.J. Baltimore D. Mol. Cell. Biol. 1994; 14: 2883-2894Crossref PubMed Scopus (161) Google Scholar,9Tian M. Martin G.S. Mol. Biol. Cell. 1997; 8: 1183-1193Crossref PubMed Scopus (6) Google Scholar). Furthermore, the pattern of tyrosine-phosphorylated proteins in cells transfected with chimeric tyrosine kinases containing heterologous SH2 domains is dictated by the specificity of the SH2 domain, not by that of the catalytic domains used in the chimeras (8Mayer B.J. Baltimore D. Mol. Cell. Biol. 1994; 14: 2883-2894Crossref PubMed Scopus (161) Google Scholar). The involvement of the SH2 domain in directing substrate specificity is apparent in a process termed processive phosphorylation (10Mayer B.J. Hirai H. Sakai R. Curr. Biol. 1995; 5: 296-305Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar). In this process, the kinase phosphorylates a site in the substrate that becomes a high affinity binding site for the SH2 domain. Interaction between this site and the SH2 domain of the kinase facilitates phosphorylation of subsequent tyrosines in the substrate. In support of this notion, we have shown previously that Src kinases phosphorylate peptide substrates containing SH2-binding sequences 10-fold more efficiently than controls (11Pellicena P. Stowell K.R. Miller W.T. J. Biol. Chem. 1998; 273: 15325-15328Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). Examples of the role of the SH2 domain in processive phosphorylation include phosphorylation of RNA polymerase by the nonreceptor tyrosine kinase Abl (12Duyster J. Baskaran R. Wang J.Y. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 1555-1559Crossref PubMed Scopus (108) Google Scholar) and phosphorylation of ITAM motifs in the ζ chain of the T cell receptor by the Src family kinase Lck (13Lewis L.A. Chung C.D. Chen J. Parnes J.R. Moran M. Patel V.P. Miceli M.C. J. Immunol. 1997; 159: 2292-2300PubMed Google Scholar). By virtue of their phosphotyrosine binding abilities, SH2 domains can coordinate a sequence of phosphorylation events when multiple target sites are present in the same substrate. Processive phosphorylation can conceivably arise from polyproline-SH3 interactions as well. The SH3 domains of Src family kinases recognize proline-rich sequences that can adopt a polyproline type II helix. An example of enhanced phosphorylation involving SH3-polyproline interactions involves the actin filament-associated protein AFAP-110 and Src. The integrity of the polyproline motif in AFAP-110 is necessary for stable complex formation with Src. Impaired phosphorylation in vivo is observed in a mutant lacking this polyproline. Thus, SH3-mediated interactions facilitate the presentation of AFAP-110 for tyrosine phosphorylation by Src (14Guappone A.C. Flynn D.C. Mol. Cell. Biochem. 1997; 75: 243-252Crossref Scopus (47) Google Scholar). Because both the SH2 and SH3 domains are involved in the intramolecular inhibition of Src, substrates possessing binding motifs for these domains could activate the kinase. The majority of Src substrates identified to date contain SH3/2 binding motifs, or both (4Wu J. Ma Q.N. Lam K.S. Biochemistry. 1994; 33: 14825-14833Crossref PubMed Scopus (101) Google Scholar). p130Cas (Crk-associated substrate) is one such substrate. Cas belongs to a family of structurally related proteins that also includes Hef and Sin (see Ref. 15O'Neill G.M. Fashena S.J. Golemis E.A. Trends Cell Biol. 2000; 10: 111-119Abstract Full Text Full Text PDF PubMed Scopus (266) Google Scholar for review). It was identified originally as a prominently tyrosine-phosphorylated protein in cells transformed by the v-src or v-crkoncogenes (16Sakai R. Iwamatsu A. Hirano N. Ogawa S. Tanaka T. Mano H. Yazaki Y. Hirai H. EMBO J. 1994; 13: 3748-3756Crossref PubMed Scopus (598) Google Scholar). Cas contains an N-terminal SH3 domain that is responsible for its localization into focal adhesions and interacts with the focal adhesion kinase FAK (Fig. 1A) (17Nakamoto T. Sakai R. Honda H. Ogawa S. Ueno H. Suzuki T. Aizawa S. Yazaki Y. Hirai H. Mol. Cell. Biol. 1997; 17: 3884-3897Crossref PubMed Scopus (138) Google Scholar). The central "substrate domain" of Cas contains 15 potential phosphorylation sites with the consensus YXXP. Nine of these motifs are potential Crk SH2 domain-binding sites (7Songyang Z. Shoelson S.E. Chaudhuri M. Gish G. Pawson T. Haser W.G. King F. Roberts T. Ratnofsky S. Lechleider R.J. Neel B.G. Birge R.B. Fajardo J.E. Chou M.M. Hanafusa H. Schaffhausen B. Cantley L.C. Cell. 1993; 72: 767-778Abstract Full Text PDF PubMed Scopus (2462) Google Scholar). Cas also has N- and C-terminal proline-rich sequences that could potentially interact with the SH3 domain of Src. Finally, when phosphorylated, Tyr-668 (in the sequence pYDYV) fits the consensus sequence for high affinity Src SH2 domain binding. Both Tyr-668 and the C-terminal polyproline sequence of Cas are known to be binding sites for Src (18Nakamoto T. Sakai R. Ozawa K. Yazaki Y. Hirai H. J. Biol. Chem. 1996; 271: 8959-8965Abstract Full Text Full Text PDF PubMed Scopus (216) Google Scholar, 19Burnham M.R. Harte M.T. Richardson A. Parsons J.T. Bouton A.H. Oncogene. 1996; 12: 2467-2472PubMed Google Scholar). Indeed, mutations in this region result in impaired phosphorylation of Casin vivo (18Nakamoto T. Sakai R. Ozawa K. Yazaki Y. Hirai H. J. Biol. Chem. 1996; 271: 8959-8965Abstract Full Text Full Text PDF PubMed Scopus (216) Google Scholar). The exact biological function of Cas is still unclear. Cas undergoes rapid phosphorylation after mitogenic stimulation and in response to fibronectin attachment via integrin receptors (20Petruzzelli L. Takami M. Herrera R. J. Biol. Chem. 1996; 271: 7796-7801Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar, 21Ojaniemi M. Vuori K. J. Biol. Chem. 1997; 272: 25993-25998Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar, 22Nakamura I. Jimi E. Duong L.T. Sasaki T. Takahashi N. Rodan G.A. Suda T. J. Biol. Chem. 1998; 273: 11144-11149Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). It has been implicated in processes as diverse as cell migration, cell cycle control, apoptosis, and signal transduction by a variety of transmembrane receptors (15O'Neill G.M. Fashena S.J. Golemis E.A. Trends Cell Biol. 2000; 10: 111-119Abstract Full Text Full Text PDF PubMed Scopus (266) Google Scholar). The modular nature of Cas suggests its involvement in the creation of multiprotein complexes, and as such, it has been proposed to act as a docking intermediary during the formation of cytoskeleton- dependent signaling networks. In principle, phosphorylation of Cas by Src could proceed by either a processive or nonprocessive (distributive) mechanism. In the processive mechanism, Src would remain bound to Cas during multiple phosphorylation events. In the nonprocessive mechanism, Src would dissociate from its substrate after each phosphorylation event. Because Cas contains 15 potential phosphorylation sites in the substrate domain, a processive mechanism would confer speed and efficiency to the reaction. Kinetic experiments with a peptide model system indicate that Src can phosphorylate substrates by a processive mechanism (11Pellicena P. Stowell K.R. Miller W.T. J. Biol. Chem. 1998; 273: 15325-15328Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar,23Scott M.P. Miller W.T. Biochemistry. 2000; 39: 14531-14537Crossref PubMed Scopus (44) Google Scholar). Given the existence of multiple complementary domains in both kinase and substrate, the phosphorylation of Cas by Src is likely to be complex. The mechanistic details of Cas phosphorylation and the role of each domain or motif have not been examined closely. In this study, we show that the C-terminal polyproline sequence of Cas is the primary region involved in complex formation between Cas and Src. This sequence not only serves to anchor kinase and substrate, allowing processive phosphorylation, but it also serves as a kinase activator through the process of SH3 domain displacement. Cas and related Src substrates therefore play a role in directing their own phosphorylation. The antiphosphotyrosine antibody 4G10 was purchased from Upstate Biotechnology. The monoclonal anti-p130Cas antibody was obtained from Transduction Laboratories. Expression and purification of C-terminally phosphorylated (down-regulated) Hck has been described previously (24Sicheri F. Moarefi I. Kuriyan J. Nature. 1997; 385: 602-609Crossref PubMed Scopus (1050) Google Scholar). Briefly, human Hck comprising the SH3, SH2, and catalytic domains was coexpressed with CSK in a baculovirus expression system. Phosphorylation of the C-terminal tail on Tyr-527 was verified by mass spectrometry. Autophosphorylation of Y416 (c-Src numbering) was performed by incubation of the enzyme (5 mg/ml) on ice for 1 h in kinase assay buffer (20 mm Tris, pH 7.5/20 mmMgCl2) in the presence of 2 mm ATP (25Moarefi I. LaFevre-Bernt M. Sicheri F. Huse M. Lee C.H. Kuriyan J. Miller W.T. Nature. 1997; 385: 650-653Crossref PubMed Scopus (543) Google Scholar). The autophosphorylated enzyme was then diluted in kinase assay buffer and used for activity measurements. Full-length v-Src was produced using a baculovirus vector in Sf9 cells and purified by immunoaffinity chromatography, as described (26Garcia P. Shoelson S.E. George S.T. Hinds D.A. Goldberg A.R. Miller W.T. J. Biol. Chem. 1993; 268: 25146-25151Abstract Full Text PDF PubMed Google Scholar). The cloning, expression, and purification of His-v-Src has been described previously (27Yokoyama N. Miller W.T. FEBS Lett. 1999; 456: 403-408Crossref PubMed Scopus (13) Google Scholar). Kinase activity was measured by a continuous spectrophotometric assay (28Barker S.C. Kassel D.B. Weigl D. Huang X. Luther M.A. Knight W.B. Biochemistry. 1995; 34: 14843-14851Crossref PubMed Scopus (164) Google Scholar). In this assay, the production of ADP is coupled to the oxidation of NADH and measured as a reduction in absorbance at 340 nm. Reactions were carried at 30 °C in 500 µl of buffer containing 100 mm Tris, pH 7.5, 10 mmMgCl2, 0.5 mm ATP, 1 mmphosphoenolpyruvate, 0.28 mm NADH, 89 units/ml pyruvate kinase, 124 units/ml lactate dehydrogenase, and the indicated amount of the peptide substrate AEEEIYGEFEAKKKKG (2Songyang Z. Carraway III, K.L. Eck M.J. Harrison S.C. Feldman R.A. Mohammadi M. Schlessinger J. Hubbard S.R. Smith D.P. Eng C. Lorenzo M.J. Poner B.A.J. Mayer B.J. Cantley L.C. Nature. 1995; 373: 536-539Crossref PubMed Scopus (861) Google Scholar) or recombinant Cas protein. Site-directed mutagenesis was accomplished using the QuikChange site-directed mutagenesis kit from Stratagene following manufacturer recommendations. All the mutations introduced were verified by DNA sequencing on an ABI373 automated DNA sequencer. The yeast expression vectors used in the yeast two-hybrid studies were a gift from Dr. James Bliska (State University of New York at Stony Brook). pBDMI vectors encode the binding domain of GAL4 and carry the marker TRP1. pADMI vectors encode the activation domain of GAL4 and carry the markerLEU2. pADMI-Cas encodes full-length rat Cas fused to the activation domain. pADMI-Cas/Src additionally coexpresses an active form of c-Src (G2E, Y416F, Y527F) (29Keegan K. Cooper J.A. Oncogene. 1996; 12: 1537-1544PubMed Google Scholar). The short form of rat Caswas subcloned from the vector pADMI-Cas (a generous gift of James Bliska, State University of New York at Stony Brook) as aBamHI/NotI fragment into pFastBac HTb (Life Technologies, Inc.) to produce N-terminally histidine-tagged proteins in the baculovirus expression system. Cas mutants CasY668F and CasPPX were generated by site-directed mutagenesis performed directly on pFastBac HTb-Cas or pADMI-Cas vectors. The forward and reverse primers used to generate CasY668F were GGGGGTTGGATGGAGGACTTTGACTACGTTCATCTGC and GCAGATGAACGTAGTCAAAGTCCTCCATCCAACCCCC, respectively. To obtain CasPPX, the C-terminal polyproline sequence in Cas RPLPSPPKF was mutated to RSLGSPGKF using the forward and reverse primers CCAGTCACGCTCTCTAGGCTCACCTGGAAAGTTCACCTCCC and GGGAGGTGAACTTTCCAGGTGAGCCTAGAGAGCGTGACTGG, respectively. v-src DNA from the Schmidt-Ruppin strain of Rous sarcoma virus (encoding amino acids 77–526, comprising the SH3, SH2, and catalytic domains of v-Src) was subcloned from a pGEX2T-SH3-SH2-catalytic domain plasmid (30Xu B. Miller W.T. Mol. Cell. Biochem. 1996; 158: 57-63PubMed Google Scholar) into pFastBacHTb (Life Technologies, Inc.) or pBDMI as aBamHI/EcoRI fragment. To make catalytically inactive v-Src (v-SrcKD) Lys-295 was mutated to arginine using the forward and reverse primers AGAGTGGCCATAAGGACTCTGAAGCCC and GGGCTTCAGAGTCCTTATGGCCACTCT, respectively. The SH2 domain-inactive v-Src (vSrcSH2D) was constructed by mutating R175K using the primers ACCTTCTTGGTCAAGGAGAGCGAGACG and CGTCTCGCTCTCCTTGACCAAGAAGGT, respectively. c-Src (G2E, Y416F, Y527F) was obtained by polymerase chain reaction amplification of plasmid pBTM116 (29Keegan K. Cooper J.A. Oncogene. 1996; 12: 1537-1544PubMed Google Scholar) using primers that introduced a BamHI site at the 5′ end and anEcoRI site at the 3′ end. The mammalian expression vector EBB-Crk encoding wild-type chicken Crk2 was a gift from Dr. Bruce Mayer (University of Connecticut Health Science Center). Crk was subcloned into pBDMI as a BamHI/NotI fragment. Because this construct generated a positive signal in the yeast two-hybrid assay in the absence of activation domain partners, we introduced a stop codon/XbaI site at codon 125 resulting in the production of the SH2 domain of Crk alone. The forward and reverse primers used were GTTTCCCGATCCATCTAGAACAGTGGCG and CGCCACTGTTCCTAGATGGATCGGGAAAC, respectively. Generation of recombinant baculovirus expressing N-terminal polyhistidine-tagged Cas and mutants was accomplished following manufacturer recommendations (Life Technologies, Inc.). Sf9 cells were grown at 27 °C in Excell 401 (JRH Biosciences) in the presence of 5% fetal calf serum (Cellgro) and 1% penicillin/streptomycin (Life Technologies, Inc.). Approximately 600 ml of cells at a density of 1.5–2 × 106 cells/ml were infected for a period of 72 h at a multiplicity of infection of 5–10 plaque-forming units/cell. The cells were centrifuged, rinsed once in phosphate-buffered saline, and stored at −70 °C until needed. Purification of histidine-tagged Cas and mutants was carried out following the Bac-to-Bac Baculovirus Expression System instruction manual (Life Technologies, Inc.) with some modifications. All steps were carried out at 4 °C. Cell pellets corresponding to 600–1200-ml cultures of Sf9 cells were lysed twice in a French pressure cell at 650 p.s.i. in lysis buffer (50 mm Tris-HCl, pH 8.5, 5 mm 2-mercaptoethanol, 100 mm KCl, 1 mm phenylmethylsulfonyl fluoride, and 1% Nonidet P-40 plus protease inhibitors). The lysate was centrifuged at 10,000 ×g for 15 min and dialyzed against buffer A (20 mm Tris-HCl, pH 8.5, 500 mm KCl, 20 mm imidazole, 5 mm 2-mercaptoethanol, and 10% (v/v) glycerol). The lysate was then applied to a column containing 5 ml of nickel-nitrilotriacetic acid resin (Qiagen) followed by a 10-volume wash in buffer A. The column was then washed with 2 volumes of buffer B (20 mm Tris-HCl, pH 8.5, 1 m KCl, 5 mm 2-mercaptoethanol, and 10% (v/v) glycerol). The column was further washed with 2 volumes of buffer A prior to the elution of the protein. Elution was accomplished with buffer C (20 mmTris-HCl, pH 8.5, 100 mm KCl, 100 mm imidazole, 5 mm 2-mercaptoethanol, and 10% (v/v) glycerol). Depending on the purity of the fractions eluted from the nickel-nitrilotriacetic acid column, in some cases Cas was further purified by fast protein liquid chromatography on an analytical MonoQ HR5/5 column (Amersham Pharmacia Biotech). The protein eluted at ∼250 mm NaCl. Purified Cas was stored at −20 °C in 20 mm Tris, pH 7.5, 50 mm KCl, 10% glycerol, and 1 mmdithiothreitol. The yield of Cas proteins varied from mutant to mutant. The overall yield/liter of Sf9 cells used was 2–3 mg for Cas wild type, 0.2 mg for CasY668F, and 6 mg for CasPPX. Yeast two-hybrid experiments were carried out using the yeast strain Y153 (MATa ura3-52leu2-3, 112 his3-200 ade2-101trp1-901 gal4Δ gal80Δ LYS2::GAL1-HIS3 GAL1::GAL1-lacZ). General procedures for yeast growth and maintenance are described elsewhere (31Fields S. Sternglanz R. Trends Genet. 1994; 10: 286-292Abstract Full Text PDF PubMed Scopus (530) Google Scholar, 32Fields S. Song O. Nature. 1989; 340: 245-246Crossref PubMed Scopus (4971) Google Scholar). The yeast transformation was carried out using the lithium acetate method and 0.5 µg of plasmid (31Fields S. Sternglanz R. Trends Genet. 1994; 10: 286-292Abstract Full Text PDF PubMed Scopus (530) Google Scholar). Double transformants were selected on Leu-Trp SD-selective growth agar plates (31Fields S. Sternglanz R. Trends Genet. 1994; 10: 286-292Abstract Full Text PDF PubMed Scopus (530) Google Scholar). β-galactosidase assays were performed in two ways. (i) In the filter assay colonies were transferred to a Whatman No. 1 filter, lysed by freezing in liquid nitrogen, layered onto another filter presoaked with 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside/Z buffer, and incubated at 30 °C until a blue color developed (31Fields S. Sternglanz R. Trends Genet. 1994; 10: 286-292Abstract Full Text PDF PubMed Scopus (530) Google Scholar). (ii) For quantitation of β-galactosidase activity 3–5 independent transformants were grown in selective media until midlog phase. The cells were normalized by A 600 nm, and the same number of cells was used for each measurement. After lysis with chloroform/SDS, the activity of β-galactosidase was detected by spectrophotometrically measuring cleavage of the chromogenic substrate o-nitrophenyl-3-D-galactoside (31Fields S. Sternglanz R. Trends Genet. 1994; 10: 286-292Abstract Full Text PDF PubMed Scopus (530) Google Scholar). For pulse-chase experiments, purified recombinant Cas and v-Src were incubated in the presence of 0.1 µm [γ-32P]ATP, 10 mmMgCl2, and 100 mm Tris-HCl, pH 7.5, for 10 min on ice. This was followed by a chase containing 0.5 mmunlabeled ATP, and aliquots of the reaction were withdrawn at the specified times. The reactions were analyzed by SDS/PAGE on an 8% acrylamide/0.2% bis-acrylamide gel, and phosphorylated Cas was detected by autoradiography. To further separate intermediate products in some experiments, the reactions were analyzed by SDS/PAGE on a 9% acrylamide/0.075% bis-acrylamide gel. For experiments in which the total phosphorylation of Cas was monitored, the indicated amounts of CasWT and CasPPX were incubated in the presence of 150 nm His-v-Src and 0.25 mm[γ-32]ATP (140 cpm/pmol). The reactions were stopped at the indicated times by mixing with Laemmli Buffer and boiling and were analyzed by SDS/PAGE followed by autoradiography. To test the processive phosphorylation model, we first employed the yeast two-hybrid system. Yeast contain no true tyrosine kinases, therefore phosphotyrosine-dependent interactions can be attributed to the introduced kinase and not to endogenous yeast proteins. To test whether interactions between Cas and Src can occur in the yeast system, we constructed the following yeast expression vectors: (i) full-length Cas was fused to the activation domain of GAL4, and (ii) v-Src (or c-Src) was fused to the binding domain (BD) of GAL4. For v-Src, we used a portion of the gene encoding the SH3, SH2, and catalytic domains but lacking the unique region. Both forms of Src were fused to the C terminus of the binding domain of GAL4, and consequently the final fusion products were not myristoylated. Antiphosphotyrosine Western blots of yeast lysates showed elevated levels of tyrosine-phosphorylated proteins in yeast lysates expressing both forms of Src (data not shown), implying that our BD-Src fusion products were active. Cas and Src are capable of interacting in this system, as revealed by a filter-binding assay and by measuring the β-galactosidase activity of yeast lysates (Fig.1 B). Co-transfection of Cas with the empty binding domain vector results in undetectable β-galactosidase activity (Fig. 1 B). Thus, the observed interaction between Cas and Src is specific. To test the importance of the Src SH2 domain in binding to Cas, we produced a Cas mutant (Y668F) in the site that binds the Src SH2 domain (Fig. 1 A). Mutation of this site or a mutation in the Src SH2 domain (R175K) that abrogates phosphotyrosine binding (v-SrcSH2D) had little effect on the interaction between Cas and Src (Fig. 1 B). Furthermore, catalytically inactive v-Src (K295R) is still capable of interacting with Cas (data not shown), confirming that the primary interaction between the two proteins is not SH2 domain- or phosphotyrosine-dependent. Cas contains a polyproline region conforming to the type II consensus SH3 domain-binding sequence, RXLPPLPRΦ (Φ = hydrophobic amino acid) (Fig. 1 A). It has been reported previously that mutation of the C-terminal polyproline leads to impaired phosphorylation of Cas in mammalian cells (18Nakamoto T. Sakai R. Ozawa K. Yazaki Y. Hirai H. J. Biol. Chem. 1996; 271: 8959-8965Abstract Full Text Full Text PDF PubMed Scopus (216) Google Scholar). We mutated the C-terminal polyproline sequence of Cas from RPLPSPP to RSLGSPG. We assayed the interaction between this mutant, designated CasPPX, and Src. The amount of β-galactosidase activity measured in these double transformants was the same as the negative control (Fig.1 C). Therefore, disrupting the C-terminal polyproline of Cas can completely abolish binding between Cas and Src. The experiments described above test the importance of certain regions of Cas in binding to Src. We developed a second yeast two-hybrid assay to probe their involvement in the phosphorylation of Cas by Src. The substrate domain of Cas contains 15 potential phosphorylation sites with the consensus YXXP. Nine of these motifs conform to the optimal Crk SH2 domain-binding site (7Songyang Z. Shoelson S.E. Chaudhuri M. Gish G. Pawson T. Haser W.G. King F. Roberts T. Ratnofsky S. Lechleider R.J. Neel B.G. Birge R.B. Fajardo J.E. Chou M.M. Hanafusa H. Schaffhausen B. Cantley L.C. Cell. 1993; 72: 767-778Abstract Full Text PDF PubMed Scopus (2462) Google Scholar). Therefore, we fused CrkSH2 to the binding domain of GAL4 and used it as a "reporter" for the phosphorylation status of Cas. The results are summarized in Fig.2. Binding between Cas and CrkSH2 occurs only when Src is coexpressed in the system, confirming that the interaction between Cas and CrkSH2 is phosphotyrosine-dependent (Fig. 2). This assay showed no difference in phosphorylation between CasWT and CasY668F. In contrast, CasPPX exhibits reduced phosphorylation of the substrate domain when compared with both CasWT and CasY668F (Fig. 2). However, interacti