AMPK Interactome Reveals New Function in Non-homologous End Joining DNA Repair

Adenosine monophosphate-activated protein kinase (AMPK) is an obligate heterotrimer that consists of a catalytic subunit (α) and two regulatory subunits (β and γ). AMPK is a key enzyme in the regulation of cellular energy homeostasis. It has been well studied and is known to function in many cellular pathways. However, the interactome of AMPK has not yet been systematically established, although protein-protein interaction is critically important for protein function and regulation. Here, we used tandem-affinity purification, coupled with mass spectrometry (TAP-MS) analysis, to determine the interactome of AMPK and its functions. We conducted a TAP-MS analysis of all seven AMPK subunits. We identified 138 candidate high-confidence interacting proteins (HCIPs) of AMPK, which allowed us to build an interaction network of AMPK complexes. Five candidate AMPK-binding proteins were experimentally validated, underlining the reliability of our data set. Furthermore, we demonstrated that AMPK acts with a strong AMPK-binding protein, Artemis, in non-homologous end joining. Collectively, our study established the first AMPK interactome and uncovered a new function of AMPK in DNA repair. Adenosine monophosphate-activated protein kinase (AMPK) is an obligate heterotrimer that consists of a catalytic subunit (α) and two regulatory subunits (β and γ). AMPK is a key enzyme in the regulation of cellular energy homeostasis. It has been well studied and is known to function in many cellular pathways. However, the interactome of AMPK has not yet been systematically established, although protein-protein interaction is critically important for protein function and regulation. Here, we used tandem-affinity purification, coupled with mass spectrometry (TAP-MS) analysis, to determine the interactome of AMPK and its functions. We conducted a TAP-MS analysis of all seven AMPK subunits. We identified 138 candidate high-confidence interacting proteins (HCIPs) of AMPK, which allowed us to build an interaction network of AMPK complexes. Five candidate AMPK-binding proteins were experimentally validated, underlining the reliability of our data set. Furthermore, we demonstrated that AMPK acts with a strong AMPK-binding protein, Artemis, in non-homologous end joining. Collectively, our study established the first AMPK interactome and uncovered a new function of AMPK in DNA repair. Adenosine monophosphate-activated protein kinase (AMPK) 1The abbreviations used are:AMPKadenosine monophosphate-activated protein kinaseCAMKKβcalmodulin-dependent protein kinase kinase betaCRAPomecontaminant repository for affinity purificationDCTL-dopachrome tautomeraseENTR1endosome-associated-trafficking regulator 1HCIPhigh-confidence candidate interacting proteinHPLChigh-performance liquid chromatographyIRionizing radiationLKB1tumor suppressor liver kinase B1NHEJnon-homologous end joiningPARS2probable proline–tRNA ligasePCRpolymerase chain reactionPRKDCDNA-dependent protein kinase catalytic subunitPSMpeptide-spectrum matchSAINTsignificance analysis of interactomeTAP-MStandem affinity purification and mass spectrometryUBE2O(E3-independent) E2 ubiquitin-conjugating enzymeXRCC5/6x-ray repair cross-complementing protein 5/6. 1The abbreviations used are:AMPKadenosine monophosphate-activated protein kinaseCAMKKβcalmodulin-dependent protein kinase kinase betaCRAPomecontaminant repository for affinity purificationDCTL-dopachrome tautomeraseENTR1endosome-associated-trafficking regulator 1HCIPhigh-confidence candidate interacting proteinHPLChigh-performance liquid chromatographyIRionizing radiationLKB1tumor suppressor liver kinase B1NHEJnon-homologous end joiningPARS2probable proline–tRNA ligasePCRpolymerase chain reactionPRKDCDNA-dependent protein kinase catalytic subunitPSMpeptide-spectrum matchSAINTsignificance analysis of interactomeTAP-MStandem affinity purification and mass spectrometryUBE2O(E3-independent) E2 ubiquitin-conjugating enzymeXRCC5/6x-ray repair cross-complementing protein 5/6. has been identified as a key enzyme that regulates energy homeostasis, which is crucial for cell survival (1Hardie D.G. Ross F.A. Hawley S.A. AMPK: a nutrient and energy sensor that maintains energy homeostasis.Nat. Rev. Mol. Cell Biol. 2012; 13: 251-262Crossref PubMed Scopus (2932) Google Scholar). When the ratios of AMP/ATP or ADP/ATP increase, AMPK is activated and regulates many downstream pathways, such as glucose metabolism, protein metabolism, fatty acid metabolism, autophagy, and mitochondrial homeostasis (2Mihaylova M.M. Shaw R.J. The AMPK signalling pathway coordinates cell growth, autophagy and metabolism.Nat. Cell Biol. 2011; 13: 1016-1023Crossref PubMed Scopus (1996) Google Scholar). As a result, AMPK positively regulates signaling pathways to generate more ATP and inhibits the anabolic pathways that consume ATP. adenosine monophosphate-activated protein kinase calmodulin-dependent protein kinase kinase beta contaminant repository for affinity purification L-dopachrome tautomerase endosome-associated-trafficking regulator 1 high-confidence candidate interacting protein high-performance liquid chromatography ionizing radiation tumor suppressor liver kinase B1 non-homologous end joining probable proline–tRNA ligase polymerase chain reaction DNA-dependent protein kinase catalytic subunit peptide-spectrum match significance analysis of interactome tandem affinity purification and mass spectrometry (E3-independent) E2 ubiquitin-conjugating enzyme x-ray repair cross-complementing protein 5/6. adenosine monophosphate-activated protein kinase calmodulin-dependent protein kinase kinase beta contaminant repository for affinity purification L-dopachrome tautomerase endosome-associated-trafficking regulator 1 high-confidence candidate interacting protein high-performance liquid chromatography ionizing radiation tumor suppressor liver kinase B1 non-homologous end joining probable proline–tRNA ligase polymerase chain reaction DNA-dependent protein kinase catalytic subunit peptide-spectrum match significance analysis of interactome tandem affinity purification and mass spectrometry (E3-independent) E2 ubiquitin-conjugating enzyme x-ray repair cross-complementing protein 5/6. AMPK is an obligate heterotrimer consisting of a catalytic subunit (α) and two regulatory subunits (β and γ). In mammals, there are two α subunits (α1 and α2), two β subunits (β1 and β2), and three γ subunits (γ1, γ2, and γ3) (3Stapleton D. Mitchelhill K.I. Gao G. Widmer J. Michell B.J. Teh T. House C.M. Fernandez C.S. Cox T. Witters L.A. Kemp B.E. Mammalian AMP-activated protein kinase subfamily.J. Biol. Chem. 1996; 271: 611-614Abstract Full Text Full Text PDF PubMed Scopus (564) Google Scholar). The tumor suppressor liver kinase B1 (LKB1) and calmodulin-dependent protein kinase kinase beta (CAMKKβ) are two upstream AMPK regulators that control AMPK activity (4Hurley R.L. Anderson K.A. Franzone J.M. Kemp B.E. Means A.R. Witters L.A. The Ca2+/calmodulin-dependent protein kinase kinases are AMP-activated protein kinase kinases.J. Biol. Chem. 2005; 280: 29060-29066Abstract Full Text Full Text PDF PubMed Scopus (813) Google Scholar, 5Hong S.P. Leiper F.C. Woods A. Carling D. Carlson M. Activation of yeast Snf1 and mammalian AMP-activated protein kinase by upstream kinases.Proc. Natl. Acad. Sci. U.S.A. 2003; 100: 8839-8843Crossref PubMed Scopus (479) Google Scholar). In response to distinct stimuli, they activate AMPK by phosphorylating the activation loop T172 in the catalytic subunit α (6Woods A. Vertommen D. Neumann D. Turk R. Bayliss J. Schlattner U. Wallimann T. Carling D. Rider M.H. Identification of phosphorylation sites in AMP-activated protein kinase (AMPK) for upstream AMPK kinases and study of their roles by site-directed mutagenesis.J. Biol. Chem. 2003; 278: 28434-28442Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar). AMPK is involved in different downstream pathways through the phosphorylation of its substrates. More and more AMPK substrates have been identified, which reveal a common conserved AMPK substrate motif (7Gwinn D.M. Shackelford D.B. Egan D.F. Mihaylova M.M. Mery A. Vasquez D.S. Turk B.E. Shaw R.J. AMPK phosphorylation of raptor mediates a metabolic checkpoint.Mol. Cell. 2008; 30: 214-226Abstract Full Text Full Text PDF PubMed Scopus (2761) Google Scholar). Screening for AMPK substrates has been attempted via different strategies, such as 14–3-3 binding and AMPK substrate motif searching (7Gwinn D.M. Shackelford D.B. Egan D.F. Mihaylova M.M. Mery A. Vasquez D.S. Turk B.E. Shaw R.J. AMPK phosphorylation of raptor mediates a metabolic checkpoint.Mol. Cell. 2008; 30: 214-226Abstract Full Text Full Text PDF PubMed Scopus (2761) Google Scholar, 8Egan D.F. Shackelford D.B. Mihaylova M.M. Gelino S. Kohnz R.A. Mair W. Vasquez D.S. Joshi A. Gwinn D.M. Taylor R. Asara J.M. Fitzpatrick J. Dillin A. Viollet B. Kundu M. Hansen M. Shaw R.J. Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy.Science. 2011; 331: 456-461Crossref PubMed Scopus (1823) Google Scholar), a chemical genetic screen and peptide capture (9Schaffer B.E. Levin R.S. Hertz N.T. Maures T.J. Schoof M.L. Hollstein P.E. Benayoun B.A. Banko M.R. Shaw R.J. Shokat K.M. Brunet A. Identification of AMPK Phosphorylation Sites Reveals a Network of Proteins Involved in Cell Invasion and Facilitates Large-Scale Substrate Prediction.Cell Metab. 2015; 22: 907-921Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar), a global phosphoproteomic analysis (10Hoffman N.J. Parker B.L. Chaudhuri R. Fisher-Wellman K.H. Kleinert M. Humphrey S.J. Yang P. Holliday M. Trefely S. Fazakerley D.J. Stockli J. Burchfield J.G. Jensen T.E. Jothi R. Kiens B. Wojtaszewski J.F. Richter E.A. James D.E. Global Phosphoproteomic Analysis of Human Skeletal Muscle Reveals a Network of Exercise-Regulated Kinases and AMPK Substrates.Cell Metab. 2015; 22: 922-935Abstract Full Text Full Text PDF PubMed Scopus (253) Google Scholar, 11Chen Z. Lei C. Wang C. Li N. Srivastava M. Tang M. Zhang H. Choi J.M. Jung S.Y. Qin J. Chen J. Global phosphoproteomic analysis reveals ARMC10 as an AMPK substrate that regulates mitochondrial dynamics.Nat. Commun. 2019; 10: 104Crossref PubMed Scopus (35) Google Scholar), and an anti-AMPK motif antibody pulldown assay (12Ducommun S. Deak M. Sumpton D. Ford R.J. Nunez Galindo A. Kussmann M. Viollet B. Steinberg G.R. Foretz M. Dayon L. Morrice N.A. Sakamoto K. Motif affinity and mass spectrometry proteomic approach for the discovery of cellular AMPK targets: identification of mitochondrial fission factor as a new AMPK substrate.Cell Signal. 2015; 27: 978-988Crossref PubMed Scopus (110) Google Scholar). Together, the functions of these newly identified AMPK substrates confirm that AMPK participates in many different biological processes. Physical contacts between proteins in vivo are crucial for their regulation and function (13De Las Rivas J. Fontanillo C. Protein-protein interactions essentials: key concepts to building and analyzing interactome networks.PLoS Comput. Biol. 2010; 6: e1000807Crossref PubMed Scopus (433) Google Scholar). Affinity purification combined with an MS-based analysis is highly efficient and has advantages in protein interactome research (14Moon S. Han D. Kim Y. Jin J. Ho W.K. Kim Y. Interactome analysis of AMP-activated protein kinase (AMPK)-alpha1 and -beta1 in INS-1 pancreatic beta-cells by affinity purification-mass spectrometry.Sci. Rep. 2014; 4: 4376Crossref PubMed Scopus (34) Google Scholar, 15Behrends C. Sowa M.E. Gygi S.P. Harper J.W. Network organization of the human autophagy system.Nature. 2010; 466: U68-U84Crossref PubMed Scopus (1187) Google Scholar, 16Varjosalo M. Sacco R. Stukalov A. van Drogen A. Planyavsky M. Hauri S. Aebersold R. Bennett K.L. Colinge J. Gstaiger M. Superti-Furga G. Interlaboratory reproducibility of large-scale human protein-complex analysis by standardized AP-MSMS.Nat. Methods. 2013; 10: 307Crossref PubMed Scopus (0) Google Scholar, 17Varjosalo M. Sacco R. Stukalov A. van Drogen A. Planyavsky M. Hauri S. Aebersold R. Bennett K.L. Colinge J. Gstaiger M. Superti-Furga G. Interlaboratory reproducibility of large-scale human protein-complex analysis by standardized AP-MS.Nat. Methods. 2013; 10: 307-314Crossref PubMed Scopus (147) Google Scholar). To identify candidate binding partners of the AMPK complex, Moon et al. purified AMPKα1 and AMPKβ1 subunits using overexpressed Myc-tagged AMPK subunits and Myc-tag antibody, followed by an MS analysis (14Moon S. Han D. Kim Y. Jin J. Ho W.K. Kim Y. Interactome analysis of AMP-activated protein kinase (AMPK)-alpha1 and -beta1 in INS-1 pancreatic beta-cells by affinity purification-mass spectrometry.Sci. Rep. 2014; 4: 4376Crossref PubMed Scopus (34) Google Scholar). Pilot-Storch et al. used the yeast two-hybrid system to screen for the interactome of the PI3K-mTOR pathway genes that include one of the AMPK complex subunits, AMPKα1. They identified 27 interactors that potentially bind to AMPKα1 (18Pilot-Storck F. Chopin E. Rual J.F. Baudot A. Dobrokhotov P. Robinson-Rechavi M. Brun C. Cusick M.E. Hill D.E. Schaeffer L. Vidal M. Goillot E. Interactome mapping of the phosphatidylinositol 3-kinase-mammalian target of rapamycin pathway identifies deformed epidermal autoregulatory factor-1 as a new glycogen synthase kinase-3 interactor.Mol. Cell Proteomics. 2010; 9: 1578-1593Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar). However, a comprehensive analysis of the AMPK interactome, which includes all seven AMPK subunits, has yet to be conducted. In this report, we used our modified tandem affinity purification and mass spectrometry (TAP-MS) analysis to characterize the interactomes of the seven AMPK subunits (AMPKα1 and α2, AMPKβ1 and β2, and AMPKγ1, γ2, and γ3). We generated stable cell lines that express these SFB-tagged (S-protein, FLAG, and streptavidin binding peptide) AMPK subunits in HEK293T cells. Interactome data filtration was performed using three different methods: upgraded significance analysis of interactome (SAINTexpress) (19Teo G. Liu G. Zhang J. Nesvizhskii A.I. Gingras A.C. Choi H. SAINTexpress: improvements and additional features in Significance Analysis of INTeractome software.J. Proteomics. 2014; 100: 37-43Crossref PubMed Scopus (294) Google Scholar), contaminant repository for affinity purification (CRAPome) (20Mellacheruvu D. Wright Z. Couzens A.L. Lambert J.P. St-Denis N.A. Li T. Miteva Y.V. Hauri S. Sardiu M.E. Low T.Y. Halim V.A. Bagshaw R.D. Hubner N.C. Al-Hakim A. Bouchard A. Faubert D. Fermin D. Dunham W.H. Goudreault M. Lin Z.Y. Badillo B.G. Pawson T. Durocher D. Coulombe B. Aebersold R. Superti-Furga G. Colinge J. Heck A.J. Choi H. Gstaiger M. Mohammed S. Cristea I.M. Bennett K.L. Washburn M.P. Raught B. Ewing R.M. Gingras A.C. Nesvizhskii A.I. The CRAPome: a contaminant repository for affinity purification-mass spectrometry data.Nat. Methods. 2013; 10: 730-736Crossref PubMed Scopus (923) Google Scholar), and enrichment analysis (21Chen Z. Tran M. Tang M. Wang W. Gong Z. Chen J. Proteomic Analysis Reveals a Novel Mutator S (MutS) Partner Involved in Mismatch Repair Pathway.Mol. Cell Proteomics. 2016; 15: 1299-1308Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar); we identified 138 candidate high-confidence interacting proteins (HCIPs) that may bind to AMPK subunits. With this list of HCIPs, we built an interaction network that included all seven AMPK subunits. We then selected five putative AMPK binding proteins and experimentally validated their interactions with AMPK. We revealed a new function of AMPK in non-homologous end joining (NHEJ) repair through its interaction with Artemis. TAP-MS analyses of seven AMPK subunits were performed using two biological replicates in HEK293T cells. The raw MS data were searched using Mascot, and the identified proteins and peptides were filtered by FDR<0.01 at the peptide level using the target-decoy method. The identified proteins were filtered for HCIPs using three strategies: SAINTexpress, CRAPome, and background enrichment. The negative control TAP-MS group in these data analyses included 46 experiments with baits that had no reported connection to the AMPK signaling pathway. The peptide-spectrum match (PSM) value of the identified protein was used in the HCIP analysis. The functional enrichment of the HCIPs was revealed by an Ingenuity Pathway Analysis (22Kramer A. Green J. Pollard Jr, J. Tugendreich S. Causal analysis approaches in Ingenuity Pathway Analysis.Bioinformatics. 2014; 30: 523-530Crossref PubMed Scopus (2811) Google Scholar) (Qiagen, Inc., Germantown, MD). The clonogenic survival assays were performed using at least three biological replicates, and a statistical analysis was performed using Student's t test. HEK293T and HEK293A cells were purchased from the American Type Culture Collection and maintained in Dulbecco modified essential medium supplemented with 10% fetal bovine serum at 37 °C in 5% CO2 (v/v). The culture media contained 1% penicillin and streptomycin. Plasmid transfection was performed with polyethyleneimine reagent, as reported previously (23Longo P.A. Kavran J.M. Kim M.S. Leahy D.J. Transient mammalian cell transfection with polyethylenimine (PEI).Methods Enzymol. 2013; 529: 227-240Crossref PubMed Scopus (316) Google Scholar). The plasmids were purchased from Harvard Plasmids Resource, addgene, or Open Biosystems. All expression constructs were generated by polymerase chain reaction and subcloned into pDONOR201 vector as the entry clones using Gateway Technology (Invitrogen, Carlsbad CA). All the entry clones were subsequently recombined into a lentiviral-gateway-compatible destination vector to determine the expression of N-terminal triple-tagged (S protein, Flag epitope, and streptavidin-binding peptide) fusion proteins (24Srivastava M. Chen Z. Zhang H. Tang M. Wang C. Jung S.Y. Chen J. Replisome dynamics and their functional relevance upon DNA damage through the PCNA interactome.Cell Rep. 2018; 25 (e3864): 3869-3883Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar). Anti-AMPKα1 (2795S), anti-AMPKα2 (2757S), anti-AMPKβ1 (4178S), anti-AMPKβ2 (4148S), anti-AMPKγ1 (4187S), anti-AMPKγ2 (2536S), and anti-Artemis (13381S) were purchased from Cell Signaling Technology (Danvers, MA) and used at 1:1000 dilution. Anti-(E3-independent) E2 ubiquitin-conjugating enzyme (UBE2O) antibody was purchased from Bethyl Laboratories (Montgomery, TX) and used at 1:2000 dilution. Anti-α-tubulin (T6199–200UL) and anti-Flag (M2) (F3165–5MG) monoclonal antibodies were purchased from Sigma-Aldrich (St. Louis, MO) and used at 1:5000 dilution. Anti-endosome-associated-trafficking regulator 1 (ENTR1) (sc-398909) was purchased from Santa Cruz Biotechnology (Dallas, TX) and used at 1:200 dilution in the immunofluorescence analysis. HEK293T cells were transfected with plasmids encoding SFB-tagged AMPK family subunits or control proteins. Stable cell lines were selected with media containing 2 μg/ml puromycin and confirmed by immunostaining and Western blot analysis. For tandem affinity purification, HEK293T cells were subjected to lysis with NETN buffer (100 mm NaCl; 1 mm EDTA; 20 mm Tris HCl; and 0.5% Nonidet P-40) and protease inhibitors at 4 °C for 20 min. Crude lysates were subjected to centrifugation at 14,000 rpm for 20 min at 4 °C. The supernatant was incubated with streptavidin-conjugated beads (GE Healthcare, Chicago, IL) for 2 h at 4 °C. The beads were washed three times with NETN buffer, and bounded proteins were eluted with NETN buffer containing 2 mg/ml biotin (Sigma-Aldrich) for 1 h at 4 °C. The elutes were incubated with S-protein agarose (Sigma-Aldrich) for 2 h, followed by three washes using NETN buffer. The beads were subjected to SDS-PAGE, and the gel was fixed and stained with Coomassie brilliant blue. The whole lane of the sample in the gel was excised and subjected to MS analysis. To generate a profiling background control for the HCIP analysis, we fractionated the HEK293T cell lysates into 18 fractions by SDS-PAGE gel and then analyzed them by MS using the same method that was used in the tandem affinity purification sample analysis. The excised gel bands were de-stained completely and washed with H2O three times before being dehydrated with 75% acetonitrile and subjected to trypsin (V5280, Promega Corporation, Madison, WI) digestion in 50 mm NH4HCO3 at 37 °C overnight. The peptides were extracted with acetonitrile and vacuum dried. The samples were reconstituted in the MS loading solution (2% acetonitrile and 0.1% formic acid), delivered onto a nano reverse-phase high-performance liquid chromatography system, and eluted with 5–35% acetonitrile gradient containing 0.1% formic acid for 75 min at 700 nL/min. The eluate was electrosprayed into LTQ Orbitrap Velos Pro MS (Thermo Fisher Scientific, Waltham, MA) under positive ion mode and in a data-dependent manner, with a full MS scan of 350–1200 m/z, resolution of 60,000, minimum signal threshold of 1000, and isolation width of 2 Da. The MS/MS spectra from the raw data were treated with Proteome Discoverer 1.4 (Thermo Fisher Scientific) and searched against the database using Mascot 2.4 (Matrix Science, Boston, MA), with proteins in Homo sapiens downloaded from Uniprot (March 2015, 20,203 entries). An automatic decoy database search was performed. Several parameters in Mascot were set for peptide searching, including oxidation for methionine and carboxyamidomethyl for cysteine as variable modifications, tolerance of two missed cleavages of trypsin, and a precursor mass tolerance of 10 ppm; the product ion tolerance was 0.5 Da. The identified peptides were filtered by Percolator, using a "Strict" Target FDR level of 0.01 based on the target-decoy method. The peptides were grouped into proteins by Proteome Discoverer, which removed the proteins that did not have unique peptides. Common contaminants were excluded. To evaluate potential protein-protein interactions, we assessed the identified peptides using the SAINTexpress method. The PSMs from AMPK proteins and the control group were assembled as a matrix for all of the bait and prey proteins. The interactions with a probability score > 0.8 from the SAINTexpress analysis were kept for the following analysis. We also used CRAPome to remove the high-count background contaminants. The interactions with a FC-B score < 2 were removed from the list. We compared the TAP-MS analysis results to the background using the HEK293T proteome profiling results, following a previously reported strategy (21Chen Z. Tran M. Tang M. Wang W. Gong Z. Chen J. Proteomic Analysis Reveals a Novel Mutator S (MutS) Partner Involved in Mismatch Repair Pathway.Mol. Cell Proteomics. 2016; 15: 1299-1308Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar). Proteins with a fold of enrichment > 2 were kept as candidate binding proteins. Using these three different analyses, we only chose the prey proteins that passed all three cut-off values as our HCIPs. The interactome network of AMPK family genes was generated by Cytoscape (25Shannon P. Markiel A. Ozier O. Baliga N.S. Wang J.T. Ramage D. Amin N. Schwikowski B. Ideker T. Cytoscape: a software environment for integrated models of biomolecular interaction networks.Genome Res. 2003; 13: 2498-2504Crossref PubMed Scopus (25650) Google Scholar) based on these HCIPs. We used the Ingenuity Pathway Analysis to reveal the potential functional pathways involving these AMPK HCIPs against the background data set of all human proteins. For the pulldown assay, 1 × 107 cells were lysed with NETN buffer containing protease inhibitors on ice for 20 min. The cell lysates were collected after centrifugation and incubated with 20 μl of S-beads for 2 h at 4 °C. The beads were washed with NETN buffer three times and boiled in 2× Laemmli buffer. The samples were resolved using SDS-polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride membrane; immunoblotting was carried out with antibodies as indicated in the figures. The guide RNAs that targeted Artemis were designed using an online tool, CHOPCHOP (26Montague T.G. Cruz J.M. Gagnon J.A. Church G.M. Valen E. CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing.Nucleic Acids Res. 2014; 42: W401-W407Crossref PubMed Scopus (688) Google Scholar), and ligated into the LentiCRISPR plasmid according to a previously described protocol (27Shalem O. Sanjana N.E. Hartenian E. Shi X. Scott D.A. Mikkelson T. Heckl D. Ebert B.L. Root D.E. Doench J.G. Zhang F. Genome-scale CRISPR-Cas9 knockout screening in human cells.Science. 2014; 343: 84-87Crossref PubMed Scopus (3124) Google Scholar). The guide RNAs used to generate Artemis knockout clones were CTTCGATAGGGAGAACCTGA GGG and CTCCATAGACCGCTTCGATA GGG. They were co-transfected with Cas9 expression construct into HEK293A cells. Twenty-four hours later, we treated the cells with puromycin for 2 days and then placed them in 96-well plates. After 12 days of cell incubation, single clones were analyzed by Western blot analysis to screen for Artemis knockout cell clones. The clonogenic survival assays were performed as described in a previous paper (28Wang C. Wang G. Feng X. Shepherd P. Zhang J. Tang M. Chen Z. Srivastava M. McLaughlin M.E. Navone N.M. Hart G.T. Chen J. Genome-wide CRISPR screens reveal synthetic lethality of RNASEH2 deficiency and ATR inhibition.Oncogene. 2019; 38: 2451-2463Crossref PubMed Scopus (65) Google Scholar). In brief, 250 cells were seeded onto 6-well plates, including HEK293A WT, AMPKα1/α2 double knockout, and Artemis knockout cells. Twenty-four hours later, the cells were exposed to different doses of ionizing radiation (IR). After IR treatment, the cells were incubated for 12 days. The colonies were stained with crystal violet and counted manually. The results were the averages of data from three independent experiments, and the statistical analysis was performed using Student's t test. To determine the interaction network of the AMPK complex, we used the seven AMPK subunits (AMPKα1 and α2, β1 and β2, and γ1, γ2, and γ3) to perform a TAP-MS analysis following the protocol shown in Fig. 1A. We first generated HEK293T derivative cell lines that stably express the respective SFB-tagged AMPK subunits and verified these stable clones by Western blotting analyses (Fig. 1B). Cell lysates were extracted, followed by TAP purification. The enriched proteins were digested by Trypsin and analyzed by LTQ-Orbitrap Velos Pro MS (Thermo Fisher Scientific); the results were searched against the Homo sapiens database using Mascot. A biological repeat was conducted for each AMPK subunit. The protein and peptide identification list for each bait protein can be found in supplemental Tables S1 and S2. AMPK functions as a protein complex that consists of three AMPK subunits. We confirmed the identification of each subunit from the TAP-MS results. As shown in Fig. 1C and Supplemental Fig. S1A–S1C, the subunits were captured with relatively high PSMs. However, AMPKγ3 was not identified in any of the TAP-MS analyses using other AMPK subunits. We checked the protein expression level using the whole proteome profiling data of HEK293T cells and the protein abundance database (supplemental Fig. S1D and S1E); the abundance of AMPKγ3 was much lower than that of any other AMPK subunits. However, when we overexpressed AMPKγ3 and performed the TAP-MS analysis, the two AMPKα subunits and two AMPKβ subunits were found to have high PSMs, indicating that they were able to bind strongly to the AMPKγ3 subunit. The TAP-MS results revealed that there was no interaction between AMPKα1 and AMPKα2. A similar situation appeared to be true for the other isoforms of the same AMPK subunit, except that we identified one unique peptide of AMPKβ2 in the AMPKβ1 purification and two unique peptides of AMPKγ1 in the AMPKγ2 purification. The protein sequence similarity between AMPK subunits is high (e.g. 75% between AMPKα1 and AMPKα2); therefore, we determined whether this was the reason for the weak or absent interactions among AMPK isoforms. We performed an in-silico prediction of peptides obtained following trypsin digestion for all AMPK subunits. In this analysis, any peptides with fewer than seven amino acids were removed. In total, we obtained 35 peptides for AMPKα1 and 33 peptides for AMPKα2. There are only four shared peptides between AMPKα1 and AMPKα2. For the other AMPK subunits, there is one shared peptide between AMPKβ1 (16 peptides) and AMPKβ2 (15 peptides); three between AMPKγ1 (21 peptides) and AMPKγ2 (33 peptides); and one between AMPKγ3 (23 peptides) and AMPKγ1 or AMPKγ2 subunits. There is no common peptide among the three AMPKγ subunits. Therefore, the shared peptides between AMPK subunits is not as high as one may think based on the identities of their protein sequences. In addition, we checked the identified peptides and found that we failed to detect AMPKα1 and AMPKα2 in each other's IP samples, because there was no unique peptide identified in these IPs. Based on the results of these analyses, we believe that different isoforms of the same subunits show very little or no interaction. We filtered the TAP-MS results following the strategy we published previously (21Chen Z. Tran M. Tang M. Wang W. Gong Z. Chen J. Proteomic Analysis Reveals a Novel Mutator S (MutS) Partner Involved in Mismatch Repair Pathway.Mol. Cell Proteomics. 2016; 15: 1299-1308Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar). We used CRAPome and SAINTexpress to compare the AMPK subunit TAP-MS results to those of negative controls, which included 46 TAP-MS results with baits that are not functionally related to AMPK. We obtained 1709 proteins that scored FC_B > 2 CRAPome and 523 proteins that scored > 0.8 with SAINTexpress. We compared the TAP-MS res