摘要
CSX/Nkx2.5 transcription factor plays a pivotal role in cardiac development; however, its role in development and differentiation of other organs has not been investigated. In this study, we used C2C12 myoblasts and human fetal primary myoblasts to investigate the function of Nkx2.5 in skeletal myogenesis. The expression levels of Nkx2.5 decreased as C2C12 myoblasts elongated and fused to form myotubes. The expression of human NKX2.5 in C2C12 myoblasts inhibited myocyte differentiation and myotube formation, and up-regulated Gata4 and Tbx5 expression. The expression of NKX2.5 in terminally differentiated C2C12 myotubes resulted in a change in morphology and breakdown into smaller myotubes. Furthermore, overexpression of NKX2.5 in C2C12 cells and primary cultures of human fetal myoblasts led to differentiation of myoblasts into neuron-like cells and expression of neuronal markers. This study sheds light on the previously unknown non-cardiac functions of Nkx2.5 transcription factor. CSX/Nkx2.5 transcription factor plays a pivotal role in cardiac development; however, its role in development and differentiation of other organs has not been investigated. In this study, we used C2C12 myoblasts and human fetal primary myoblasts to investigate the function of Nkx2.5 in skeletal myogenesis. The expression levels of Nkx2.5 decreased as C2C12 myoblasts elongated and fused to form myotubes. The expression of human NKX2.5 in C2C12 myoblasts inhibited myocyte differentiation and myotube formation, and up-regulated Gata4 and Tbx5 expression. The expression of NKX2.5 in terminally differentiated C2C12 myotubes resulted in a change in morphology and breakdown into smaller myotubes. Furthermore, overexpression of NKX2.5 in C2C12 cells and primary cultures of human fetal myoblasts led to differentiation of myoblasts into neuron-like cells and expression of neuronal markers. This study sheds light on the previously unknown non-cardiac functions of Nkx2.5 transcription factor. The cardiac and skeletal muscle progenitor cells are derived from the mesoderm and are committed to their lineages early in embryogenesis. The molecular pathway(s) involved in differentiation of myocytes from their progenitor cells is not well understood. The transcription factor CSX/Nkx2.5, a vertebrate homolog of Drosophila Tinman, is one of the earliest determinants of the cardiac cell lineage and is detected mainly in cardiac progenitors and pharyngeal endoderm as early as 7.5 days post coitum (1Evans S.M. Semin. Cell Dev. Biol. 1999; 10: 73-83Crossref PubMed Scopus (57) Google Scholar, 2Lints T.J. Parsons L.M. Hartley L. Lyons I. Harvey R.P. Development (Camb.). 1993; 119: 419-431Crossref PubMed Google Scholar, 3Bruneau B.G. Circ. Res. 2002; 90: 509-519Crossref PubMed Scopus (219) Google Scholar). Recent findings have indicated that Nkx2.5 is essential for myocardial cell lineage specification and development of the cardiac conduction system (4Pashmforoush M. Lu J.T. Chen H. Amand T.S. Kondo R. Pradervand S. Evans S.M. Clark B. Feramisco J.R. Giles W. Ho S.Y. Benson D.W. Silberbach M. Shou W. Chien K.R. Cell. 2004; 117: 373-386Abstract Full Text Full Text PDF PubMed Scopus (365) Google Scholar, 5Jay P.Y. Harris B.S. Maguire C.T. Buerger A. Wakimoto H. Tanaka M. Kupershmidt S. Roden D.M. Schultheiss T.M. O'Brien T.X. Gourdie R.G. Berul C.I. Izumo S. J. Clin. Investig. 2004; 113: 1130-1137Crossref PubMed Scopus (208) Google Scholar). The extracardiac expression and function of Nkx2.5 is controversial (2Lints T.J. Parsons L.M. Hartley L. Lyons I. Harvey R.P. Development (Camb.). 1993; 119: 419-431Crossref PubMed Google Scholar, 6Komuro I. Izumo S. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8145-8149Crossref PubMed Scopus (464) Google Scholar). Nkx2.5 expression has been demonstrated in a subset of the cranial skeletal muscle, spleen, stomach, liver, tongue, and anterior larynx in addition to the heart (7Kasahara H. Bartunkova S. Schinke M. Tanaka M. Izumo S. Circ. Res. 1998; 82: 936-946Crossref PubMed Scopus (132) Google Scholar) suggesting that Nkx2.5 might play a role in development of these organs. The homozygous deletion of Nkx2.5 in mice is lethal at the early stages of development because of defective looping of the heart tube (8Tanaka M. Chen Z. Bartunkova S. Yamasaki N. Izumo S. Development (Camb.). 1999; 126: 1269-1280PubMed Google Scholar), and therefore it has been difficult to study the function of Nkx2.5 in development of other organs as well as in the differentiation and maturation of cardiac myocytes. Notwithstanding its function in embryonic cardiac development, Nkx2.5 overexpression seems to be detrimental in postnatal cardiac myocyte and dramatically changes the cardiac cell structure and function (9Kasahara H. Ueyama T. Wakimoto H. Liu M.K. Maguire C.T. Converso K.L. Kang P.M. Manning W.J. Lawitts J. Paul D.L. Berul C.I. Izumo S. J. Mol. Cell Cardiol. 2003; 35: 243-256Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). The transcriptional regulatory network governing the cardiac myocyte differentiation is not completely elucidated; however, it is known that Nkx2.5 physically interacts with other transcription factors such as GATA4 and Tbx5 to synergistically activate target cardiac-specific genes (10Sepulveda J.L. Vlahopoulos S. Iyer D. Belaguli N. Schwartz R.J. J. Biol. Chem. 2002; 277: 25775-25782Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar, 11Monzen K. Shiojima I. Hiroi Y. Kudoh S. Oka T. Takimoto E. Hayashi D. Hosoda T. Habara-Ohkubo A. Nakaoka T. Fujita T. Yazaki Y. Komuro I. Mol. Cell. Biol. 1999; 19: 7096-7105Crossref PubMed Scopus (214) Google Scholar, 12Hiroi Y. Kudoh S. Monzen K. Ikeda Y. Yazaki Y. Nagai R. Komuro I. Nat. Genet. 2001; 28: 276-280Crossref PubMed Scopus (481) Google Scholar). The C2C12 myoblast cell line has been used extensively in the study of skeletal myogenesis (13Andres V. Walsh K. J. Cell Biol. 1996; 132: 657-666Crossref PubMed Scopus (505) Google Scholar). When cultured in the presence of growth factors, these myoblasts proliferate as mononucleated cells and express muscle regulatory factors such as MyoD and Myf-5. C2C12 myoblasts terminally differentiate into skeletal myocyte and fuse to form multinucleated myotubes when cultured to confluence and deprived of growth factors. A fraction of C2C12 cells (reserve cells, 20–50% of cells) remain in a proliferating undifferentiated state. The expression of transcription factors myogenin and MRF-4 significantly increases as myoblasts elongate and fuse to form myotubes, whereas cell cycle-regulatory proteins such as cyclin A are down-regulated (14Wang J. Nadal-Ginard B. Biochem. Biophys. Res. Commun. 1995; 206: 82-88Crossref PubMed Scopus (33) Google Scholar). Here we have investigated the expression of Nkx2.5 and its function in myogenesis and demonstrate that Nkx2.5 expression level is critical for myocyte differentiation and myotube formation. In addition, overexpression of Nkx2.5 in myoblasts results in expression of neuronal markers suggesting a role for this gene or a gene under Nkx2.5 regulation in neurogenesis. Culturing C2C12 and Primary Myoblasts—C2C12 cells were obtained from ATCC. Cells were normally cultured in growth medium, Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and penicillin/streptomycin at 37 °C with 10% CO2. To allow cells to differentiate, medium was changed to Dulbecco's modified Eagle's medium supplemented with 2% horse serum. Approximately 70% of the cells differentiated and fused to form myotubes after 3–5 days in a routine experiment. Mouse and human fetal skeletal myoblast preparation was done according to a published protocol for mouse myoblast preparation (15Springer M.L. Blau H.M. Somatic Cell Mol. Genet. 1997; 23: 203-209Crossref PubMed Scopus (68) Google Scholar) with some modifications. Approval of the institute ethics committee was obtained for collecting samples from terminated pregnancies. Approximately 70% of prepared myoblasts fused to form myotubes in Dulbecco's modified Eagle's medium supplemented with 1% serum. To isolate C2C12 myotubes, myoblasts were allowed to form myotubes in differentiation medium. The myotubes were detached by brief exposure to trypsin (0.05% + EDTA) and were passed through a 100-μm filter and seeded at 2–4 myotubes/mm2 on a gridded 35-mm dish. The next day the cells were briefly treated with distilled H2O to remove the contaminating myoblasts and maintained in media containing 2% horse serum. Adenoviral Expression of NKX2.5—To express NKX2.5 from adenovirus, AdEasy adenoviral expression system was obtained from Stratagene. Human NKX2.5 (accession number: BC025711) cDNA was amplified from fetal heart RNA (Clontech) using primers AGACTGGTCGACTGCCACCATGTTCC and AGAGTCAGGGATCCTAGTTGAGGTG, digested with SalI and BamHI and cloned into the AdTrack-CMV vector (Invitrogen) in forward or reverse orientations. Manufacturer's instructions were followed for virus production. Adenoviral titers and multiplicity of infection (MOI) 1The abbreviations used are: MOI, multiplicity of infection; GFP, green fluorescent protein; RT, reverse transcription; MyHC, myosin heavy chain; BrdUrd, bromodeoxyuridine; DAPI, 4′,6-diamidino-2-phenylindole. were estimated in human embryonic kidney-293 cells by counting the number of GFP+ cells, 24 h after infection. The recombinant adenoviruses were used at 2–20 MOI for primary and C2C12 myoblasts and at ∼200 MOI to infect myotubes. Cell Cycle Analysis—The standard method for cell cycle analysis using DNA staining by propidium iodide was used. Briefly, cells were fixed in 70% ethanol, rinsed with phosphate-buffered saline, stained with 50 μg/ml propidium iodide, and analyzed by fluorescence-activated cell sorter. Real Time RT-PCR—Total RNA was prepared using TRIzol solution (Invitrogen) and reverse transcribed using SuperScript II (Invitrogen). For real time PCR analysis either TaqMan assay (assay-on-demand for mouse myogenin and Nkx2.5, Applied Biosystems) or SYBR Green (for Tbx5, Gata4) was used. Data were analyzed by relative quantitation method using standard curve. The following sets of primers were used for SYBR Green real time assay or in one-step RT-PCR (kit from Qiagen) analysis: Nkx2.5, GGCGTCGGGGACTTGAACACC, CGCACTCACTTTAATGGGAAG; Gata4, CTTGAGGCATGGCACATCTCTGCA, TAATGGTGGGAGATGGGAA; Tbx-5, GCAGGGCCTGAGTACCTCTT, GGCTGATGGGCCACTGAGGT; myogenin, CACTCCCTTACGTCCATCGTG, CGGCAGCTTTACAAACAACAC; glyceraldehyde-3-phosphate dehydrogenase, TCCACCACCCTGTTGCTGTAG, GACCACAGTCCATGCCATCACT; and synapsin-I, GCAACGGAGACTACCGCAGTTTG, TTGTCTTCATCCTGGTGGTCACC. PCR conditions for all the primers were 94 °C for 15 s, 58 °C for 30 s, and 72 °C for 1s for 26–30 cycles. Immunofluorescence, Immunoprecipitation, and Western Analysis— MyHC antibody (MF-20) was obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD, National Institutes of Health and maintained by the University of Iowa, Iowa City, IA. Other antibodies were purchased. Nkx2.5, MyoD, p21, p27, and cyclin A were purchased from Santa Cruz, myogenin was purchased from Pharmingen, nestin and NeuN were purchased from Chemicon, and BrdUrd antibody was from Pharmingen. Immunofluorescence and Western blot analysis were performed according to standard procedure. Immunoprecipitation of Nkx2.5 was performed using 400 μg of whole cell lysates and 1 μg of anti Nkx2.5 antibody. Statistical Analysis—Results are expressed as mean ± S.D. unless otherwise indicated. Statistical significance was determined by oneway analysis of variance. p < 0.05 was used to determine a significant difference. We examined the expression of Nkx2.5 and myogenin in C2C12 cells at different stages of differentiation using real time RT-PCR. RNA was prepared from C2C12 cells at day -1 (subconfluent), and at days 0 (100% confluent), 1, and 3 after the culture medium was changed to differentiation medium. The cells started to elongate at day 1, and multinucleated myotubes appeared at day 3 (not shown). Fig. 1A demonstrates a real time analysis of Nkx2.5 and myogenin RNA. The Nkx2.5 RNA level in differentiated C2C12 cells declined to about 25% of its level in the undifferentiated cells. However, myogenin was highly up-regulated (by ∼45-fold) as cells differentiated and fused (days 1–3). Accordingly, the Nkx2.5 protein was also reduced as cells underwent differentiation (Fig. 1B). Immunostaining with Nkx2.5 antibody revealed expression throughout nuclei and cytoplasm, which was absent in human umbilical cord endothelial cell culture negative control (not shown). We evaluated the role of Nkx2.5 in myocyte differentiation by overexpressing human NKX2.5 in C2C12 cells from an adenovirus. The human and mouse Nkx2.5 proteins (accession numbers BC025711 and X75415, respectively) are 87% identical (using BLAST program) and therefore expected to have fundamental properties in common. Expression of Nkx2.5 in C2C12 myoblasts and human fetal skeletal myoblasts completely blocked the formation of myotubes, as no myosin heavy chain (MyHC) protein was detected in the cells cultured for 4 days in differentiation media (Fig. 2A) indicating that Nkx2.5 modulates skeletal myogenesis. The expression levels of myogenin, MyoD, cyclin-dependent kinase inhibitors, p21 (Cip1) and p27 (Kip1), and cyclin A were also examined in the C2C12 cells overexpressing NKX2.5 in growth- and differentiation-promoting conditions. Overexpression of NKX2.5 in C2C12 cells lowered the level of MyoD and blocked the expression of myogenin. Concomitantly, p21 and p27 were significantly up-regulated in NKX2.5-expressing cells, whereas cyclin A was reduced (Fig. 2B). Furthermore, cells treated with adenovirus expressing NKX2.5 and/or GFP were analyzed with fluorescence-activated cell sorter for cell cycle analysis. As shown in Fig. 2C the percentage of cells in S phase was reduced by ∼2-fold in cultures treated with NKX2.5-expressing adenovirus after 24 h (5.125 ± 0.81% in NKX2.5-overexpressing cells versus 10.95 ± 1.23% in the GFP-expressing cells). The expression levels of transcription factor genes, Gata4 and Tbx5 were evaluated in C2C12 cells treated with increasing amounts of NKX2.5 adenovirus, using real time PCR. Both Gata4 and Tbx5 were slightly up-regulated when cells were treated with low concentrations of the adenovirus (Fig. 2D); however, higher concentrations of the adenovirus and therefore higher level of NKX2.5 expression resulted in the down-regulation of these genes. The C2C12 cells overexpressing NKX2.5 did not express cardiac-specific cell markers ANF and cTnI as examined by RT-PCR (not shown). C2C12 and human fetal myoblasts overexpressing NKX2.5 demonstrated a change in morphology 2–3 days after treatment, and displayed small, spherical, and refractive cell bodies with long cellular processes (Fig. 3, a and b) compared with normal myoblast morphology in GFP-vector-treated control cells (Fig. 3c). The majority of NKX2.5-expressing C2C12 cells were positive for the immature neuronal cell marker, nestin, 3–5 days post-treatment (Fig. 3, d–i). Nestin was also detected in differentiated myocytes and myotubes in control cells (not shown). In addition, a number of cells with neuronal morphology expressed NeuN (Fig. 3, j–l), whereas no glial fibrillary acidic protein-positive cells were detected by immunofluorescence suggesting that the majority of cells were acquiring neuronal and not glial cell characteristics. Furthermore, NKX2.5-transduced C2C12 and primary human myoblasts expressed synapsin I, a protein found in the nerve terminals and known to play a role in axonogenesis and synaptogenesis (16Chin L.S. Li L. Ferreira A. Kosik K.S. Greengard P. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 9230-9234Crossref PubMed Scopus (215) Google Scholar) (Fig. 3m). The level of synapsin-I expression in NKX2.5-expressing fetal myoblasts was similar to the RNA level detected in a fetal mouse brain (Fig. 3m, lanes 4 and 6). To further investigate the function of Nkx2.5 in myogenesis we transduced C2C12 myotubes with NKX2.5-expressing adenovirus. The myotubes, normally expressing a lower level of Nkx2.5, changed morphology and produced a bead-on-a-string appearance. Two to three days after cells were transduced with NKX2.5-adenovirus, the nuclei were positioned into separate clusters of several or sometimes single nuclei, and the sarcomeric proteins (MyHC and α-actinin) started to disappear from the cytoplasm of the myotubes (Fig. 4A). Later, constrictions appeared throughout the length of the myotubes and finally smaller myotubes or mononucleated myoblasts were separated (Fig. 4A). Almost 100% of the myotubes expressing NKX2.5 showed the morphological change, whereas a similar phenotype was rarely seen in myotubes in the control plate. To evaluate the mitotic ability of the myotubes, C2C12 myotubes were isolated, separated from myoblasts, and seeded at low density on a gridded plate before being infected with NKX2.5-expressing adenovirus. Cell cultures were then treated with BrdUrd and the number of cells undergoing DNA synthesis was evaluated using anti-BrdUrd antibody. The number of BrdUrd+ cells did not seem to significantly differ in NKX2.5-transduced cells under conditions used (Fig. 4B). Nkx2.5 is one of the earliest genes expressed in cardiac mesoderm during development and functions in association with other transcription factors such as GATA4, Tbx5, and MEF2C (3Bruneau B.G. Circ. Res. 2002; 90: 509-519Crossref PubMed Scopus (219) Google Scholar, 17Skerjanc I.S. Petropoulos H. Ridgeway A.G. Wilton S. J. Biol. Chem. 1998; 273: 34904-34910Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar) to initiate cardiac muscle differentiation. The expression of Nkx2.5 in cranial muscle and tongue in addition to the heart has been reported previously (7Kasahara H. Bartunkova S. Schinke M. Tanaka M. Izumo S. Circ. Res. 1998; 82: 936-946Crossref PubMed Scopus (132) Google Scholar). In this study we discovered a previously unknown function of Nkx2.5 in skeletal myogenesis. Our results clearly contradict a report suggesting the absence of Nkx2.5 expression in C2C12 cells (2Lints T.J. Parsons L.M. Hartley L. Lyons I. Harvey R.P. Development (Camb.). 1993; 119: 419-431Crossref PubMed Google Scholar). We used real time PCR and Western blot analysis to show expression of Nkx2.5 RNA and protein in C2C12 cells. Furthermore, we demonstrated that Nkx2.5 expression levels corresponded to the differentiation status of the skeletal myoblasts. The adenoviral expression of NKX2.5 in myoblasts prevented the differentiation into myocytes and formation of myotubes. The levels of myogenic transcription factors, MyoD and myogenin, were reduced in the NKX2.5-expressing cells. In addition, C2C12 cells expressing NKX2.5 demonstrated a in cyclin-dependent kinase inhibitors, p21 and p27, a in cyclin and cell cycle at have indicated that cell cycle and differentiation of myoblasts is with expression of p21 and p27 and down-regulation of cyclin A (14Wang J. Nadal-Ginard B. Biochem. Biophys. Res. Commun. 1995; 206: 82-88Crossref PubMed Scopus (33) Google Scholar, E. R. J. D.M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: PubMed Scopus Google Scholar, K. J. V. Walsh K. Mol. Cell. Biol. 1995; PubMed Scopus (365) Google Scholar, A. W.J. Mol. Cell. 1998; Scholar). The changes in expression of these regulatory proteins might cell cycle and differentiation of NKX2.5-expressing cells into a Expression of human NKX2.5 was not for C2C12 myoblasts into cardiac myocytes as cells did not express cardiac myocyte ANF and However, it did in the of Gata4 and Tbx5 transcription factor genes that are highly expressed during heart Our findings the of regulation of Tbx5 by Nkx2.5 T. J. Cell. Biochem. 2004; 92: PubMed Scopus Google Scholar, R.J. Development (Camb.). 1999; 126: Google Scholar). A higher level of expression of NKX2.5 resulted in down-regulation of Gata4 and This differentiation of myoblasts into cells with characteristics. expression of NKX2.5 in myoblasts resulted in a change in morphology and expression of neuronal markers indicating that either Nkx2.5 or a under its regulation is for myoblasts into neuron-like cells in The expression of Nkx2.5 has not been reported in the However, genes such as and that are involved in have Nkx2.5 in their E. M. R. S. A. J. 2002; PubMed Scopus Google Scholar, N. D. R. 1998; PubMed Scopus Google Scholar). Nkx2.5, and its are all expressed in a conduction system of the heart U. M. M. Circ. Res. 1996; PubMed Scopus Google Scholar). is that neuronal genes such as are expressed in the cardiac conduction system myocytes M. S. E. Chien K.R. L. J. Mol. Cell Cardiol. 1996; 28: Full Text PDF PubMed Scopus Google Scholar), and therefore these findings the differentiation of skeletal myoblasts into cells with of cardiac conduction cells. Furthermore, in this study we have demonstrated that expression of NKX2.5 in myotubes, normally expressing low levels of Nkx2.5, to of the and of myotubes into smaller myotubes. The of myotubes overexpressing NKX2.5 however, the of the of cells to differentiate into myoblasts or other cell was not using adenoviral expression because the majority of treated myotubes after a days in an of structure and down-regulation of and has been reported when Nkx2.5 is in (9Kasahara H. Ueyama T. Wakimoto H. Liu M.K. Maguire C.T. Converso K.L. Kang P.M. Manning W.J. Lawitts J. Paul D.L. Berul C.I. Izumo S. J. Mol. Cell Cardiol. 2003; 35: 243-256Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). In this study, was no in BrdUrd in myotubes expressing We that the of other regulatory genes is in for the cells to the cell myotubes into myoblasts has been by overexpressing a transcription A. Cell. Full Text Full Text PDF PubMed Scopus Google Scholar) and by cells to a in D. H. Nat. PubMed Scopus Google Scholar). A Nkx2.5 overexpression and of in myoblasts to be A cDNA analysis is to study the genes under Nkx2.5 regulation in skeletal In this study a unknown function of the transcription factor Nkx2.5 as a differentiation factor in skeletal myogenesis and neurogenesis. findings have in of terminally differentiated muscle and using myoblasts.