Endothelial Progenitor Cell Transplantation Improves the Survival Following Liver Injury in Mice

Background & Aims: Neovascularization, which is vital to the healing of injured tissues, recently has been found to include both angiogenesis, which involves in mature endothelial cells, and vasculogenesis, involving endothelial progenitor cells. The aim of this study was to clarify the possible roles of endothelial progenitor cells during postnatal liver regeneration. Methods: To determine how endothelial progenitor cells participate in liver regeneration, human or mouse endothelial progenitor cells were transplanted into the mice with carbon tetrachloride-induced acute liver injury. Survival rate of the mice in endothelial progenitor cell-transplanted and control groups was calculated. Separately, livers removed temporally from both groups were examined. Results: At an early stage, transplanted human endothelial progenitor cells were seen mainly surrounding hepatic central veins where hepatocytes showed extensive necrosis; later, the transplanted cells formed tubular structures. More of these cells were observed along hepatic sinusoids. Transplantation of human or mouse endothelial progenitor cells improved survival of the mice following liver injury (from 28.6% to 85.7%, P < .0005 and from 33.3% to 80.0%, P < .001, respectively), accompanied by greater proliferation of hepatocytes. Human endothelial progenitor cells produced several growth factors, such as hepatocyte growth factor, transforming growth factor-α, heparin-binding epidermal growth factor–like growth factor, and vascular endothelial growth factor, and also elicited endogenous growth factors. Conclusions: Endogenous and exogenous growth factors and direct neovascularization after endothelial progenitor cell transplantation promoted liver regeneration, thus improving survival after liver injury. Transplantation of endothelial progenitor cells could represent a new therapeutic strategy for promoting liver regeneration. Background & Aims: Neovascularization, which is vital to the healing of injured tissues, recently has been found to include both angiogenesis, which involves in mature endothelial cells, and vasculogenesis, involving endothelial progenitor cells. The aim of this study was to clarify the possible roles of endothelial progenitor cells during postnatal liver regeneration. Methods: To determine how endothelial progenitor cells participate in liver regeneration, human or mouse endothelial progenitor cells were transplanted into the mice with carbon tetrachloride-induced acute liver injury. Survival rate of the mice in endothelial progenitor cell-transplanted and control groups was calculated. Separately, livers removed temporally from both groups were examined. Results: At an early stage, transplanted human endothelial progenitor cells were seen mainly surrounding hepatic central veins where hepatocytes showed extensive necrosis; later, the transplanted cells formed tubular structures. More of these cells were observed along hepatic sinusoids. Transplantation of human or mouse endothelial progenitor cells improved survival of the mice following liver injury (from 28.6% to 85.7%, P < .0005 and from 33.3% to 80.0%, P < .001, respectively), accompanied by greater proliferation of hepatocytes. Human endothelial progenitor cells produced several growth factors, such as hepatocyte growth factor, transforming growth factor-α, heparin-binding epidermal growth factor–like growth factor, and vascular endothelial growth factor, and also elicited endogenous growth factors. Conclusions: Endogenous and exogenous growth factors and direct neovascularization after endothelial progenitor cell transplantation promoted liver regeneration, thus improving survival after liver injury. Transplantation of endothelial progenitor cells could represent a new therapeutic strategy for promoting liver regeneration. Neovascularization is critical for the healing of injured tissues as well as proliferation of carcinoma cells in vivo because both processes require a supply of growth factors, nutrients, and oxygen.1Algire G.H. Chalkley H.W. Legallais F.Y. Park H.D. Vascular reactions of normal and malignant tissues in vivo: 1. vascular reactions of mice to wounds and to normal and neoplastic transplants.J Natl Cancer Inst. 1945; 6: 73-85Crossref Scopus (393) Google Scholar, 2Folkman J. Angiogenesis in cancer, vascular, rheumatoid and other disease.Nat Med. 1995; 1: 27-31Crossref PubMed Scopus (7153) Google Scholar Vasculogenesis, originally defined as vascularization during embryogenesis from endothelial progenitor cells (EPC) or angioblasts, begins as formation of blood islands composed of EPC at the periphery and hematopoietic stem cells in the center. In distinction, postnatal neovascularization has been believed to result from proliferation, migration, and remodeling of fully differentiated endothelial cells derived from preexisting blood vessels, a process referred to as angiogenesis. However, EPC recently were isolated from human peripheral blood and were shown to be incorporated into active angiogenesis sites.3Asahara T. Murohara T. Sullivan A. Silver M. van der Zee R. Li T. Witzenbichler B. Schatteman G. Isner J.M. Isolation of putative progenitor endothelial cells for angiogenesis.Science. 1997; 275: 964-967Crossref PubMed Scopus (7588) Google Scholar Accordingly, the concept of postnatal neovascularization was revised to include both angiogenesis by mature endothelial cells and vasculogenesis by EPC. The therapeutic potential of EPC populations expanded ex vivo recently has been investigated in rodent models of ischemic disorders that require neovascularization, such as myocardial and hindlimb ischemia.4Kalka C. Masuda H. Takahashi T. Kalka-Moll W.M. Silver M. Kearney M. Li T. Isner J.M. Asahara T. Transplantation of ex vivo expanded endothelial progenitor cells for therapeutic neovascularization.Proc Natl Acad Sci U S A. 2000; 97: 3422-3427Crossref PubMed Scopus (1753) Google Scholar, 5Murohara T. Ikeda H. Duan J. Shintani S. Sasaki K. Eguchi H. Onitsuka I. Matsui K. Imaizumi T. Transplanted cord blood-derived endothelial precursor cells augment postnatal neovascularization.J Clin Invest. 2000; 105: 1527-1536Crossref PubMed Scopus (807) Google Scholar, 6Kawamoto A. Gwon H.C. Iwaguro H. Yamaguchi J.I. Uchida S. Masuda H. Silver M. Ma H. Kearney M. Isner J.M. Asahara T. Therapeutic potential of ex vivo expanded endothelial progenitor cells for myocardial ischemia.Circulation. 2001; 103: 634-637Crossref PubMed Scopus (1108) Google Scholar, 7Kawamoto A. Tkebuchava T. Yamaguchi J. Nishimura H. Yoon Y.S. Milliken C. Uchida S. Masuo O. Iwaguro H. Ma H. Hanley A. Silver M. Kearney M. Losordo D.W. Isner J.M. Asahara T. Intramyocardial transplantation of autologous endothelial progenitor cells for therapeutic neovascularization of myocardial ischemia.Circulation. 2003; 107: 461-468Crossref PubMed Scopus (576) Google Scholar Transplanted EPC proved to preserve cardiac ventricular function and to salvage limbs from necrosis in association with enhanced capillary density, supporting the therapeutic applicability of EPC transplantation to various ischemic diseases.8Tateishi-Yuyama E. Matsubara H. Murohara T. Ikeda U. Shintani S. Masaki H. Amano K. Kishimoto Y. Yoshimoto K. Akashi H. Shimada K. Iwasaka T. Imaizumi T. Therapeutic angiogenesis for patients with limb ischaemia by autologous transplantation of bone-marrow cells a pilot study and a randomised controlled trial.Lancet. 2002; 360: 427-435Abstract Full Text Full Text PDF PubMed Scopus (1542) Google Scholar In liver regeneration, sinusoidal endothelial cells (SEC), the resident endothelial cells, have been believed to proliferate, migrate, and reconstruct hepatic sinusoids.9Widmann J.J. Fahimi H.D. Proliferation of mononuclear phagocytes (Kupffer cells) and endothelial cells in regenerating rat liver.Am J Pathol. 1975; 80: 349-366PubMed Google Scholar, 10Assy N. Spira G. Paizi M. Shenkar L. Kraizer Y. Cohen T. Neufeld G. Dabbah B. Enat R. Baruch Y. Effect of vascular endothelial growth factor on hepatic regenerative activity following partial hepatectomy in rats.J Hepatol. 1999; 30: 911-915Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar, 11Taniguchi E. Sakisaka S. Matsuo K. Tanikawa K. Sata M. Expression and role of vascular endothelial growth factor in liver regeneration after partial hepatectomy in rats.J Histochem Cytochem. 2001; 49: 121-130Crossref PubMed Scopus (183) Google Scholar, 12Ross M.A. Sander C.M. Kleeb T.B. Watkins S.C. Stolz D.B. Spatiotemporal expression of angiogenesis growth factor receptors during the revascularization of regenerating rat liver.Hepatology. 2001; 34: 1135-1148Crossref PubMed Scopus (136) Google Scholar, 13Shimizu H. Miyazaki M. Wakabayashi Y. Mitsuhashi N. Kato A. Ito H. Nakagawa K. Yoshidome H. Kataoka M. Nakajima N. Vascular endothelial growth factor secreted by replicating hepatocytes induces sinusoidal endothelial cell proliferation during regeneration after partial hepatectomy in rats.J Hepatol. 2001; 34: 683-689Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar, 14Sato T. El-Assal O.N. Ono T. Yamanoi A. Dhar D.K. Nagasue N. Sinusoidal endothelial cell proliferation and expression of angiopoietin/Tie family in regenerating rat liver.J Hepatol. 2001; 34: 690-698Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar In a recent study, bone marrow-derived cells, presumed to be EPC and monocyte-lineage cells, were found to contribute to hepatic sinusoid reconstruction in liver regeneration after partial hepatectomy in mice.15Fujii H. Hirose T. Oe S. Yasuchika K. Azuma H. Fujikawa T. Nagao M. Yamaoka Y. Contribution of bone marrow cells to liver regeneration after partial hepatectomy in mice.J Hepatol. 2002; 36: 653-659Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar However, data are lacking concerning the role of EPC in liver regeneration. The aims of this study were to obtain direct evidence of vasculogenesis in liver regeneration using isolated EPC to elucidate how EPC take part in liver regeneration and to explore the possibility of therapeutic application of vasculogenesis in liver disease. Male Balb/c wild- and nude (immunologic unresponsiveness of genetically thymusless)-type mice16Kindred B. Immunological unresponsiveness of genetically thymus less (nude) mice.Eur J Immunol. 1971; 1: 59-61Crossref PubMed Scopus (50) Google Scholar weighing 20 to 22 g (Japan SCC, Shizuoka, Japan) were used in all experiments. Mice were housed at a controlled temperature (22°C) under 12 h/12 h light-dark conditions and were maintained on a standard diet with freely available water. All mouse experiments were conducted in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals and were approved by the University of Kurume Institutional Animal Care and Use Committee. To obtain EPC, mononuclear cells (MNC) were isolated from peripheral blood of healthy human volunteers or bone marrow of mice by density gradient centrifugation with Histopaque-1077 (Sigma Chemical, St. Louis, MO). Cells were collected, washed twice with 10 mmol/L phosphate-buffered saline (PBS; pH 6.8), suspended into cell culture medium described below, and plated on gelatin (Sigma)-coated culture dishes. Informed consent was obtained from all volunteers. The study protocol was conformed to the ethical guidelines of the 1975 Declaration of Helsinki as reflected in a prior approval by the Kurume University Human Research Committee. Medium 199 supplemented with 20% fetal bovine serum, bovine pituitary extract to stimulate cell growth, heparin (100 μg/mL), and antibiotics (Sigma) was used for cell culture. Attached cells thus were allowed to develop into EPC until day 10 of culture when culture dishes were washed with PBS for immunocytochemistry or 1 mmol/L EDTA in PBS for EPC collection. EPC attached to dishes were treated with trypsin-EDTA solution (Sigma) for 3 minutes, gently scraped free, and collected. After washing with PBS, EPC were suspended in PBS at a density of 105/100 μL and injected into mice as described below. In experiments to detect EPC, these cells were labeled with PKH26GL (red fluorescent cell linker kit for general cell membrane labeling, Sigma) following the manufacturer’s instructions before EPC transplantation to mice. In brief, EPC were collected from culture dishes and incubated in a solution containing PKH26 red fluorescent dye (2 μmol/L/mL) at room temperature for 5 minutes. After washing in PBS, EPC were transplanted into mice. The experimental procedure is summarized in Figure 1. To induce chemical liver injury, 200 μL/kg of carbon tetrachloride (CCl4) diluted 10% (vol/vol) with olive oil was administered intraperitoneally into the nude-type mice. Mice received an injection of 100 μL of PBS with or without 105 EPC of human or mouse into the spleen 1 day after CCl4 injection. Survival rate in the mice receiving an injection of PBS with or without human or mouse EPC was calculated until day 7 after CCl4 injection. In separate experiments, the mice were killed at 0, 1, 2, 3, 7, 14, 21, 28, and 56 days after CCl4 injection to obtain several tissues. Livers were perfused by PBS and processed for several experiments. EPC on culture dishes were fixed in 4% paraformaldehyde diluted with PBS at 4°C for 20 minutes or in equal volumes of acetone and ethanol at −20°C for 10 minutes. To block nonspecific binding of primary antibodies, dishes were preincubated with Protein Block Serum-Free (DAKO, Kyoto, Japan) for 30 minutes. Primary antibodies are listed in Table 1. As primary antibodies in immunocytochemistry, antihepatocyte growth factor (HGF),17Mizuno S. Matsumoto K. Kurosawa T. Mizuno-Horikawa Y. Nakamura T. Reciprocal balance of hepatocyte growth factor and transforming growth factor-β 1 in renal fibrosis in mice.Kidney Int. 2000; 57: 937-948Crossref PubMed Scopus (0) Google Scholar anti-transforming growth factor-α (TGF-α) (CALBIOCHEM, San Diego, CA), anti-CD34 antibody (DAKO), PE-conjugated anti-CD133 (Miltenvi Biotec GmbH, Bergisch, Gladbach, Germany), antifetal liver kinase-1 (Flk-1), anti-fms-like tyrosine kinase-1 (Flt-1), tyrosine kinase with Ig and EGF homology domains-2 (Tie-2), antiheparin-binding epidermal growth factor-like growth factor (HB-EGF), and antivascular endothelial growth factor (VEGF) antibodies (Santa Cruz Biotechnology, Palo Alto, CA) were used. Dishes were incubated at 4°C overnight with primary antibodies diluted 1:100 (vol/vol) with PBS. Dishes were incubated for 60 minutes with FITC-conjugated anti-mouse, anti-rabbit, or anti-goat IgG antibody (Cappel, Aurora, OH) diluted 1:100 (vol/vol) with PBS. Finally, to protect fluorescence staining, specimens were embedded in Vectorshield (Vector Laboratories, Burlingame, CA).Table 1Primary AntibodiesAntigenSpeciesHGFRabbitTGF-αRabbitHB-EGFGoatVEGFRabbitFlk-1RabbitFlt-1RabbitTie-2RabbitPCNARabbitCD31MouseCD34MouseCD133 (PE-conjugated)Mouse Open table in a new tab Conventionally processed and embedded sections cut at a thickness of 3 μm were deparaffinized with xylene and immersed in ethanol for 15 seconds. To block endogenous peroxidase activity, sections were then incubated in methanol with 3% H2O2 (vol/vol) for 10 minutes during deparaffinization. To perform immunostaining for proliferating cell nuclear antigen (PCNA), some sections then were autoclaved in 10 mmol/L citrate buffer at 121°C for 5 minutes and cooled slowly to room temperature. After washing in PBS with 0.05% Tween 20 (Wako, Osaka, Japan) (PBS-T), sections were preincubated with Protein Blocking Serum-Free (DAKO). Sections were primarily incubated at 4°C overnight with anti-PCNA, VEGF, or Tie-2 antibody (Santa Cruz), diluted 1:100 (vol/vol) with PBS. After washing 3 times at 4°C for 5, 10, and 15 minutes in PBS-T, sections were incubated with anti-rabbit Enivision Plus (DAKO) for 60 minutes. After washing again in PBS-T, sections were incubated in a solution containing 0.1% (wt/vol) 3-3′-diamino-benzidine-tetrahydrochloride and 0.005% (vol/vol) H2O2 in 0.1 mol/L Tris-HCl buffer (pH 7.6) for 3 minutes. Nuclear counterstaining was performed with Mayer’s hematoxylin. Frozen liver tissue sections were cut at a thickness of 6 μm. Sections were fixed in equal volumes of acetone and ethanol, washed in water, and then immersed in PBS-T. To perform immunohistochemistry in mouse liver with mouse primary antibody, following DAKO’s instructions, the anti-CD31 antibody (DAKO) and FITC-conjugated anti-mouse IgG antibody (Cappel) diluted 1:100 (vol/vol) with PBS first were incubated together for 60 minutes. To prevent reaction of excess secondary antibody to endogenous mouse IgG, the excess secondary antibody was saturated 20:1 (vol/vol) with mouse serum (DAKO) for 60 minutes. After incubation of specimens with blocking regent, they were incubated at 4°C overnight with the immunecomplex described above or with Flk-1 antibody (Santa Cruz) diluted 1:100 (vol/vol) with PBS. Sections incubated with anti-Flk-1 antibody were allowed to react with FITC-conjugated anti-rabbit IgG antibody (Cappel). Sections were embedded in Vectorshield (Vector Laboratories). Liver tissues were homogenized 1:4 (wt/vol) in a solution containing 20 mmol/L Tris-HCl buffer (pH 7.5), 2 mmol/L NaCl, 1 mmol/L PMSF, 1 mmol/L EDTA, and 0.1% Tween-20. After centrifugation, the supernatant was collected for enzyme-linked immunosorbent assay (ELISA). ELISA specific for mouse HGF was performed by SRL (Tokyo, Japan). Liver samples were obtained from 6 mice each in EPC-transplanted and control groups. Total RNA was extracted from liver tissues and EPC using Isogen (Nippon Gene, Tokyo, Japan) following the manufacturer’s instructions. RNA concentration was determined spectrophotometrically at 260/280 nm. Reverse transcription (RT) was performed to synthesize cDNA, using total RNA, random primers, deoxynucleotide triphosphates, and SuperScript III reverse transcriptase (Invitrogen Life Technology, Carlsbad, CA). The RNA and primers were mixed and denatured by heating at 70°C for 10 minutes. Next, the RT reaction mixture was incubated for 30 minutes at 50°C, followed by 15 minutes at 70°C. A no-template control was performed for each experiment, establishing the absence of genomic contamination of samples. Polymerase chain reaction (PCR) was performed for 30 cycles to amplify cDNAs encoding growth factors, using sense and antisense primers (Table 1), RT products as a template, AmpliTaq DNA polymerase (PE Applied Biosystems, Foster City, CA), and deoxynucleotide triphosphates (GIBCO, Rockville, MD) in a GeneAmp 9700 Sequence Detection System (PE Applied Biosystems). Denaturation, annealing, and primer extension, respectively, were performed at 94°C for 30 seconds, at primer-specific temperatures for 1 minute (Table 2), and 72°C for 1 minute. PCR products were analyzed on 1.5% ethidium bromide-stained agarose gels.Table 2RT-PCR Primer Sequence for Several Growth FactorsPrimerSequence (5′-3′)Tann (°C)HGF5′-Primer: GCC TGA AAG ATA TCC CGA CA663′-Primer: TTC CAT GTT CTT GTC CCA CAHB-EGF5′-Primer: AAA AGA AAG AAG AAA GGC AA663′-Primer: CTC CTA TGG TAC CTA AAC ATTGF-α5′-Primer: CGC CCT GTT CGC TCT GGG TAT663′-Primer: AGG AGG TCC GCA TGC TCA CAGVEGF5′-Primer: TCG GGC CTC CGA AAC CAT GA583′-Primer: CCT GGT GAG AGA TCT GGT TCFGF-25′-Primer: GGC CAC TTC AAG GAC CCC AAG583′-Primer: TCA GCT CTT AGC AGA CAIGF-15′-Primer: ACA TCT CCC ATC TCT CTG GAT TTC CTT TTG583′-Primer: CCC TCT ACT TGC GTT CTT CAA ATG TAC TTC Open table in a new tab Real-time semiquantitative PCR was carried out using a GeneAmp 5700 Sequence Detection System (PE Applied Biosystems). The primers were designed to distinguish between mouse and human VEGF mRNA (Table 3).Table 3Real-time-PCR Primer Sequence for Mouse and Human VEGFPrimerSequence (5′-3′)Common5′-Primer: CCGAAACCATGAACTTTCTGAMouse VEGF3′-Primer: CCATTCATGGGACTTCTGCTCHuman VEGF3′-Primer: CTTCGTGATGATTCTGCCCTCC Open table in a new tab Quantitative SYBR Green real-time PCR was performed using sense and antisense primers (Table 3), RT products, and SYBR Green PCR Core Reagents kit (PE Biosystems, Warrington, UK), according to the manufacturer’s instructions. Optimization was performed for each gene-specific primer, confirming that the primers did not produce nonspecific primer-dimmer amplification signal in a control tube lacking template. The primers for 18S rRNA were purchased from a commercial vendor (PE Life Sciences). Quantitative PCR was performed with the ABI PRISM 7000 Sequence Detection System (PE Applied Biosystems) by using 3-stage program parameters provided by the manufacturer as follows: 2 minutes at 50°C, 10 minutes at 95°C, and then 40 cycles of 15 seconds at 95°C and 1 minute at 60°C. Liver samples were obtained from at least 4 mice each in EPC-transplanted and control groups, and each of these samples was analyzed in triplicate by quantitative PCR. Data are expressed as means ± SD. Differences between groups were analyzed by the Mann–Whitney U test. Kaplan–Meier analysis with the log-rank test was used for survival comparison between groups. P values below .05 were considered indicative of statistical significance. MNC-derived cells from human peripheral blood that had attached to culture dishes formed multiple cell clusters similar to blood islands and cord-like structures resembling blood vessels on day 7 in culture (Figure 2A and B). To assess microscopically, May-Giemsa staining was performed on cells removed from dishes at day 14 of culture. Morphology of attaching cells had changed dramatically, showing eccentrically placed nuclei and abundant basophilic cytoplasm (Figure 2C). On the other hand, morphology of floating cells had not changed. In addition, mouse MNC attaching to culture dishes showed similar morphology (data not shown). These attaching cells in human MNC were immunocytochemically positive for Flk-1, Flt-1, Tie-2, CD34 (endothelial cell markers), and CD133 (stem/progenitor cell marker) (Figure 2D–I). There were no positive cells in the absence of primary antibodies (data not shown). These results confirmed that we had succeeded in culturing EPC from MNC of human peripheral blood and mouse bone marrow. Hepatocytes surrounding hepatic central veins showed extensive necrosis after CCl4 injection (represented by the livers on day 2 in control group; Figure 3A). Transplanted human EPC were observed mainly at these necrotic foci near central veins, beginning on day 2 after CCl4 injection (Figure 3B). Some EPC also were observed along hepatic sinusoids beginning on day 2 (Figure 3C). In addition, EPC were observed in bone marrow (Figure 3D). To clarify how EPC were incorporated into the architecture of hepatic sinusoids, SEC were stained immunohistochemically with CD31 and Flk-1. Human EPC with red fluorescence merged into CD31 green signals (Figure 3E–G) or Flk-1 green signals (Figure 3H–J), suggesting EPC incorporation into the sinusoidal architecture otherwise made up of SEC. Hepatocytes proliferated extensively toward hepatic central veins, and no necrotic hepatocytes were observed by day 14 after CCl4 injection. However, tubular structures, never observed in normal liver, appeared near hepatic central veins. Immunohistochemistry for Tie-2 demonstrated that the tubular structures were formed by cells of endothelial lineage in the livers on day 14 in the human EPC-transplanted group (Figure 3K), indicating that the structures could be blood vessels. Moreover, human EPC with red fluorescence formed a portion of these vessel-like structures (Figure 3L). Such structures were apparent until day 56 after CCl4 injection (data not shown). To elucidate how EPC were attracted to tissues surrounding hepatic central veins, expression of VEGF, a known mobilizing factor for EPC, was studied in regenerating liver. VEGF was detected immunohistochemically in some hepatocytes surrounding central veins on day 2 (represented in the human EPC-transplanted group; Figure 3M). There were no signals in the absence of primary antibodies. In addition, no EPC were observed in intact livers or in other organs (lung and kidney) in mice with liver injury (data not shown). To clarify the role of EPC in liver regeneration, survival rate was calculated. At first, we compared the rate between human EPC-transplanted and control groups. In the control group, 9 of 14 mice died by day 3 after CCl4 injection. Only 4 of 14 (28.6%) remained alive on day 7 after CCl4 injection. However, in the human EPC-transplanted group, 12 of 14 mice (85.7%) remained alive on day 7; only 2 mice had died by day 3. We similarly examined the role of mouse EPC in liver regeneration. In the control group, only 5 of 15 mice (33.3%) remained alive on day 7; however, 12 of 15 mice (80.0%) remained alive in the mouse EPC-transplanted group. Thus, both human and mouse EPC transplantation significantly improved survival at 7 days after CCl4-induced liver injury (Figure 4A and B). We presumed that EPC transplantation could promote proliferation of hepatocytes by day 3 after CCl4 injection. We therefore compared pathologic findings in livers on day 2 after CCl4 injection between the control and human EPC-transplanted groups. PCNA staining demonstrated much more active proliferation of hepatocytes in the human EPC-transplanted group than in the control group (Figure 5A and B). The PCNA-labeling index in the human EPC-transplanted group was significantly greater than in the control group (Figure 5C). There were no positive cells in the absence of primary antibodies (data not shown). On the other hand, necrotic change of the liver on day 2 in the human EPC-transplanted group seemed to be similar to that in the control group (data not shown). Also, there was no significant difference of alanine aminotransferase concentrations on day 2 between the control and human EPC-transplanted groups (n = 10; 10,172 ± 10,262 and 12,548 ± 15,290 U/L, respectively). Because proliferation of hepatocytes was greatly accelerated, we examined several growth factors that promote liver regeneration. RT-PCR analysis and immunocytochemistry demonstrated messenger RNA (mRNA) (Figure 6A and B) and proteins (Figure 7A to D) representing HB-EGF, TGF-α, HGF, VEGF, fibroblast growth factor (FGF)-2, and insulin-like growth factor (IGF)-I in human EPC on day 7 in vitro.Figure 7Immunocytochemistry for growth factors performed in human EPC in vitro. EPC expressed several growth factors such as HGF (A), TGF-α (B) HB-EGF (C), and VEGF (D). Scale bar = 20 μm.View Large Image Figure ViewerDownload Hi-res image Download (PPT) RT-PCR analysis further demonstrated that only in the human EPC-transplanted group, human VEGF mRNA was expressed in regenerating liver on day 2 after CCl4 injection. In contrast, mouse VEGF mRNA was expressed in regenerating liver in both the human EPC-transplanted and control groups (Figure 8A). Furthermore, real-time PCR demonstrated that the amount of mouse VEGF mRNA in the human EPC-transplanted group was significantly greater than in the control group (Figure 8B). Similarly, ELISA demonstrated significantly more abundant mouse HGF in regenerating liver at day 2 after CCl4 injection in the human EPC-transplanted group than in controls (Figure 9).Figure 9Mouse HGF concentration by ELISA. The amount of mouse HGF in livers from the EPC-transplanted group was greater than that in livers from the control group (*P < .005). Liver samples were obtained from 6 mice each in the EPC-transplanted and control groups.View Large Image Figure ViewerDownload Hi-res image Download (PPT) In the present study, we demonstrated that transplanted EPC contributed to liver regeneration in mice by participation in neovascularization and expression of multiple growth factors. In consequence, EPC transplantation significantly accelerated liver regeneration with enhanced proliferative activity of hepatocytes, resulting in the improved survival after chemically induced liver injury. Reconstruction of hepatic sinusoids as well as hepatocyte proliferation is necessary in liver regeneration. Restoration of sinusoids has been investigated mainly in terms of SEC, the resident endothelial cells. However, because EPC take part in neovascularization in myocardial and hindlimb ischemia,4Kalka C. Masuda H. Takahashi T. Kalka-Moll W.M. Silver M. Kearney M. Li T. Isner J.M. Asahara T. Transplantation of ex vivo expanded endothelial progenitor cells for therapeutic neovascularization.Proc Natl Acad Sci U S A. 2000; 97: 3422-3427Crossref PubMed Scopus (1753) Google Scholar, 5Murohara T. Ikeda H. Duan J. Shintani S. Sasaki K. Eguchi H. Onitsuka I. Matsui K. Imaizumi T. Transplanted cord blood-derived endothelial precursor cells augment postnatal neovascularization.J Clin Invest. 2000; 105: 1527-1536Crossref PubMed Scopus (807) Google Scholar, 6Kawamoto A. Gwon H.C. Iwaguro H. Yamaguchi J.I. Uchida S. Masuda H. Silver M. Ma H. Kearney M. Isner J.M. Asahara T. Therapeutic potential of ex vivo expanded endothelial progenitor cells for myocardial ischemia.Circulation. 2001; 103: 634-637Crossref PubMed Scopus (1108) Google Scholar, 7Kawamoto A. Tkebuchava T. Yamaguchi J. Nishimura H. Yoon Y.S. Milliken C. Uchida S. Masuo O. Iwaguro H. Ma H. Hanley A. Silver M. Kearney M. Losordo D.W. Isner J.M. Asahara T. Intramyocardial transplantation of autologous endothelial progenitor cells for therapeutic neovasculari