CD36 plays a negative role in the regulation of lipophagy in hepatocytes through an AMPK-dependent pathway

Fatty acid translocase cluster of differentiation (CD36) is a multifunctional membrane protein that facilitates the uptake of long-chain fatty acids. Lipophagy is autophagic degradation of lipid droplets. Accumulating evidence suggests that CD36 is involved in the regulation of intracellular signal transduction that modulates fatty acid storage or usage. However, little is known about the relationship between CD36 and lipophagy. In this study, we found that increased CD36 expression was coupled with decreased autophagy in the livers of mice treated with a high-fat diet. Overexpressing CD36 in HepG2 and Huh7 cells inhibited autophagy, while knocking down CD36 expression induced autophagy due to the increased autophagosome formation in autophagic flux. Meanwhile, knockout of CD36 in mice increased autophagy, while the reconstruction of CD36 expression in CD36-knockout mice reduced autophagy. CD36 knockdown in HepG2 cells increased lipophagy and β-oxidation, which contributed to improving lipid accumulation. In addition, CD36 expression regulated autophagy through the AMPK pathway, with phosphorylation of ULK1/Beclin1 also involved in the process. These findings suggest that CD36 is a negative regulator of autophagy, and the induction of lipophagy by ameliorating CD36 expression can be a potential therapeutic strategy for the treatment of fatty liver diseases through attenuating lipid overaccumulation. Fatty acid translocase cluster of differentiation (CD36) is a multifunctional membrane protein that facilitates the uptake of long-chain fatty acids. Lipophagy is autophagic degradation of lipid droplets. Accumulating evidence suggests that CD36 is involved in the regulation of intracellular signal transduction that modulates fatty acid storage or usage. However, little is known about the relationship between CD36 and lipophagy. In this study, we found that increased CD36 expression was coupled with decreased autophagy in the livers of mice treated with a high-fat diet. Overexpressing CD36 in HepG2 and Huh7 cells inhibited autophagy, while knocking down CD36 expression induced autophagy due to the increased autophagosome formation in autophagic flux. Meanwhile, knockout of CD36 in mice increased autophagy, while the reconstruction of CD36 expression in CD36-knockout mice reduced autophagy. CD36 knockdown in HepG2 cells increased lipophagy and β-oxidation, which contributed to improving lipid accumulation. In addition, CD36 expression regulated autophagy through the AMPK pathway, with phosphorylation of ULK1/Beclin1 also involved in the process. These findings suggest that CD36 is a negative regulator of autophagy, and the induction of lipophagy by ameliorating CD36 expression can be a potential therapeutic strategy for the treatment of fatty liver diseases through attenuating lipid overaccumulation. Nonalcoholic fatty liver disease (NAFLD) is the most common cause of liver disease worldwide, with prevalence estimates ranging from 25% to 45% (1Rinella M.E. Nonalcoholic fatty liver disease: a systematic review.JAMA. 2015; 313: 2263-2273Crossref PubMed Scopus (1480) Google Scholar). NAFLD is considered to be the liver manifestation of metabolic syndrome, which encompasses a wide spectrum beginning with steatosis (2Shen J. Chan H.L. Wong G.L. Choi P.C. Chan A.W. Chan H.Y. Chim A.M. Yeung D.K. Chan F.K. Woo J. et al.Non-invasive diagnosis of non-alcoholic steatohepatitis by combined serum biomarkers.J. Hepatol. 2012; 56: 1363-1370Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar, 3Pais R. Charlotte F. Fedchuk L. Bedossa P. Lebray P. Poynard T. Ratziu V. Group L.S. A systematic review of follow-up biopsies reveals disease progression in patients with non-alcoholic fatty liver.J. Hepatol. 2013; 59: 550-556Abstract Full Text Full Text PDF PubMed Scopus (336) Google Scholar). The cluster of differentiation 36 (CD36) belongs to the scavenger receptor family, also known as fatty acid translocase, that facilitates the uptake of long-chain fatty acids (LCFAs) and is widely expressed on the surface of many cell types in vertebrates (4Hoosdally S.J. Andress E.J. Wooding C. Martin C.A. Linton K.J. The human scavenger receptor CD36: glycosylation status and its role in trafficking and function.J. Biol. Chem. 2009; 284: 16277-16288Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 5Zhong S. Zhao L. Wang Y. Zhang C. Liu J. Wang P. Zhou W. Yang P. Varghese Z. Moorhead J.F. et al.Cluster of differentiation 36 deficiency aggravates macrophage infiltration and hepatic inflammation by upregulating monocyte chemotactic protein-1 expression of hepatocytes through histone deacetylase 2-dependent pathway.Antioxid. Redox Signal. 2017; 27: 201-214Crossref PubMed Scopus (25) Google Scholar). CD36 recognizes different ligands and may promote different intracellular signaling pathways. This multifunctional membrane glycoprotein has been studied extensively in relation to its role in the uptake of LCFAs, which are involved in NAFLD. Hepatic CD36 expression is significantly elevated in animal models and patients with NAFLD and is regarded as positively correlated with liver fat content and insulin resistance (6Miquilena-Colina M.E. Lima-Cabello E. Sanchez-Campos S. Garcia-Mediavilla M.V. Fernandez-Bermejo M. Lozano-Rodriguez T. Vargas-Castrillon J. Buque X. Ochoa B. Aspichueta P. et al.Hepatic fatty acid translocase CD36 upregulation is associated with insulin resistance, hyperinsulinaemia and increased steatosis in non-alcoholic steatohepatitis and chronic hepatitis C.Gut. 2011; 60: 1394-1402Crossref PubMed Scopus (286) Google Scholar). Accumulating evidence indicates that CD36 is not only a fatty acid transporter but also an essential regulator of intracellular fatty acid homeostasis. Recent studies have found that CD36 is involved in fatty acid oxidation by the activation of adenosine monophosphate-activated protein kinase (AMPK) (7Samovski D. Sun J. Pietka T. Gross R.W. Eckel R.H. Su X. Stahl P.D. Abumrad N.A. Regulation of AMPK activation by CD36 links fatty acid uptake to β-oxidation.Diabetes. 2015; 64: 353-359Crossref PubMed Scopus (126) Google Scholar), suggesting that it modulates fatty acid storage or usage. It has also been reported to function as a pattern recognition receptor that conducts intracellular signals and activates inflammatory pathways such as Toll-like receptor, NF-κB, and c-Jun N-terminal kinase signals to control the chronic metabolic inflammatory response (8Silverstein R.L. Febbraio M. CD36, a scavenger receptor involved in immunity, metabolism, angiogenesis, and behavior.Sci. Signal. 2009; 2: re3Crossref PubMed Scopus (708) Google Scholar, 9Kennedy D.J. Kuchibhotla S. Westfall K.M. Silverstein R.L. Morton R.E. Febbraio M. A CD36-dependent pathway enhances macrophage and adipose tissue inflammation and impairs insulin signalling.Cardiovasc. Res. 2011; 89: 604-613Crossref PubMed Scopus (127) Google Scholar, 10Stewart C.R. Stuart L.M. Wilkinson K. van Gils J.M. Deng J. Halle A. Rayner K.J. Boyer L. Zhong R. Frazier W.A. et al.CD36 ligands promote sterile inflammation through assembly of a Toll-like receptor 4 and 6 heterodimer.Nat. Immunol. 2010; 11: 155-161Crossref PubMed Scopus (1086) Google Scholar, 11Zhao L. Zhang C. Luo X. Wang P. Zhou W. Zhong S. Xie Y. Jiang Y. Yang P. Tang R. CD36 palmitoylation disrupts free fatty acid metabolism and promotes tissue inflammation in non-alcoholic steatohepatitis.J. Hepatol. 2018; 69: 705-717Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar), confirming its significance in the pathogenesis of nonalcoholic steatohepatitis. Cell autophagy maintains organelle quality control by engulfing and degrading damaged intracellular components and cytoplasmic contents such as proteins (12Ezaki J. Matsumoto N. Takedaezaki M. Komatsu M. Takahashi K. Hiraoka Y. Taka H. Fujimura T. Takehana K. Yoshida M. Liver autophagy contributes to the maintenance of blood glucose and amino acid levels.Autophagy. 2011; 7: 727-736Crossref PubMed Scopus (207) Google Scholar), glycogen (13Kotoulas O.B. Kalamidas S.A. Kondomerkos D.J. Glycogen autophagy.Microsc. Res. Tech. 2004; 64: 10-20Crossref PubMed Scopus (60) Google Scholar), and lipid droplets (14Singh R. Kaushik S. Wang Y. Xiang Y. Novak I. Komatsu M. Tanaka K. Cuervo A.M. Czaja M.J. Autophagy regulates lipid metabolism.Nature. 2009; 458: 1131-1135Crossref PubMed Scopus (2635) Google Scholar, 15Yang Z. Klionsky D.J. Eaten alive: a history of macroautophagy.Nat. Cell Biol. 2010; 12: 814-822Crossref PubMed Scopus (1636) Google Scholar). Impaired autophagy has been linked to the initial development of hepatic steatosis and the progression of steatosis to liver injury (14Singh R. Kaushik S. Wang Y. Xiang Y. Novak I. Komatsu M. Tanaka K. Cuervo A.M. Czaja M.J. Autophagy regulates lipid metabolism.Nature. 2009; 458: 1131-1135Crossref PubMed Scopus (2635) Google Scholar, 16Fukuo Y. Yamashina S. Sonoue H. Arakawa A. Nakadera E. Aoyama T. Uchiyama A. Kon K. Ikejima K. Watanabe S. Abnormality of autophagic function and cathepsin expression in the liver from patients with non-alcoholic fatty liver disease.Hepatol. Res. 2014; 44: 1026-1036Crossref PubMed Scopus (112) Google Scholar, 17Amir M. Czaja M.J. Autophagy in nonalcoholic steatohepatitis.Expert Rev. Gastroenterol. Hepatol. 2011; 5: 159-166Crossref PubMed Scopus (164) Google Scholar). The inhibition of autophagy by genetic knockdown of the autophagy gene Atg5 or pharmacological inhibition with an autophagy inhibitor significantly increased cellular triglyceride (TG) content (14Singh R. Kaushik S. Wang Y. Xiang Y. Novak I. Komatsu M. Tanaka K. Cuervo A.M. Czaja M.J. Autophagy regulates lipid metabolism.Nature. 2009; 458: 1131-1135Crossref PubMed Scopus (2635) Google Scholar, 17Amir M. Czaja M.J. Autophagy in nonalcoholic steatohepatitis.Expert Rev. Gastroenterol. Hepatol. 2011; 5: 159-166Crossref PubMed Scopus (164) Google Scholar); thus, autophagy plays a central role in the breakdown of hepatic lipid droplet-stored TG and cholesterol by lipophagy (17Amir M. Czaja M.J. Autophagy in nonalcoholic steatohepatitis.Expert Rev. Gastroenterol. Hepatol. 2011; 5: 159-166Crossref PubMed Scopus (164) Google Scholar). This is an alternative pathway of lipid metabolism acting via the lysosomal degradative pathway of autophagy, degrading lipid droplet TG and cholesterol by lysosomal acidic hydrolases. The free fatty acids generated by lipophagy from the breakdown of TGs then fuel cellular rates of mitochondrial β-oxidation. Decreased liver lipophagy aggravates hepatic lipid overaccumulation and an increased incidence of NAFLD (14Singh R. Kaushik S. Wang Y. Xiang Y. Novak I. Komatsu M. Tanaka K. Cuervo A.M. Czaja M.J. Autophagy regulates lipid metabolism.Nature. 2009; 458: 1131-1135Crossref PubMed Scopus (2635) Google Scholar). Although CD36 has been confirmed to significantly contribute to the CD5L-mediated macrophage autophagy (18Sanjurjo L. Amezaga N. Aran G. Naranjo-Gomez M. Arias L. Armengol C. Borras F.E. Sarrias M.R. The human CD5L/AIM-CD36 axis: a novel autophagy inducer in macrophages that modulates inflammatory responses.Autophagy. 2015; 11: 487-502Crossref PubMed Scopus (56) Google Scholar), the relationship between CD36 and autophagy/lipophagy is largely unknown. The potential role of CD36 in regulating lipophagy has never been addressed in NAFLD. AMPK, a serine-threonine kinase, functions as an energy and metabolic sensor in maintaining metabolic homeostasis (19Mihaylova M.M. Shaw R.J. The AMPK signalling pathway coordinates cell growth, autophagy and metabolism.Nat. Cell Biol. 2011; 13: 1016-1023Crossref PubMed Scopus (1980) Google Scholar). The activation of AMPK occurs primarily through phosphorylation of its catalytic α subunit at the Thr172 residue by liver kinase B1 (LKB1) or by Ca2+/calmodulin-dependent protein kinase kinase β (20Woods A. Johnstone S.R. Dickerson K. Leiper F.C. Fryer L.G.D. Neumann D. Schlattner U. Wallimann T. Carlson M. Carling D. LKB1 is the upstream kinase in the AMP-activated protein kinase cascade.Curr. Biol. 2003; 13: 2004-2008Abstract Full Text Full Text PDF PubMed Scopus (1332) Google Scholar, 21Woods A. Dickerson K. Heath R. Hong S.P. Momcilovic M. Johnstone S.R. Carlson M. Carling D. Ca2+/calmodulin-dependent protein kinase kinase-beta acts upstream of AMP-activated protein kinase in mammalian cells.Cell Metab. 2005; 2: 21-33Abstract Full Text Full Text PDF PubMed Scopus (1067) Google Scholar). In addition to the role of AMPK as a regulator of energy homeostasis, growing evidence has implicated AMPK in the regulation of various physiologic and pathologic pathways such as lipid metabolism, mitochondrial biogenesis, gene expression, and protein synthesis (22Guigas B. Viollet B. Targeting AMPK: from ancient drugs to new small-molecule activators.EXS. 2016; 107: 327-350PubMed Google Scholar, 23Hardie D.G. Schaffer B.E. Brunet A. AMPK: an energy-sensing pathway with multiple inputs and outputs.Trends Cell Biol. 2016; 26: 190-201Abstract Full Text Full Text PDF PubMed Scopus (546) Google Scholar). In the autophagy process, AMPK directly phosphorylates unc-51-like autophagy activating kinase 1 (ULK1) at sites Ser317, Ser555, andSer777 and phosphorylates Beclin1 at site S91/S94 to activate the proautophagy Vps34 complex, which is critical for its function in autophagy (19Mihaylova M.M. Shaw R.J. The AMPK signalling pathway coordinates cell growth, autophagy and metabolism.Nat. Cell Biol. 2011; 13: 1016-1023Crossref PubMed Scopus (1980) Google Scholar, 24Laker R.C. Drake J.C. Wilson R.J. Lira V.A. Lewellen B.M. Ryall K.A. Fisher C.C. Zhang M. Saucerman J.J. Goodyear L.J. et al.Ampk phosphorylation of Ulk1 is required for targeting of mitochondria to lysosomes in exercise-induced mitophagy.Nat. Commun. 2017; 8: 548Crossref PubMed Scopus (240) Google Scholar, 25Kim J. Kundu M. Viollet B. Guan K.L. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1.Nat. Cell Biol. 2011; 13: 132-141Crossref PubMed Scopus (4513) Google Scholar, 26Kim J. Kim Y.C. Fang C. Russell R.C. Kim J.H. Fan W. Liu R. Zhong Q. Guan K.L. Differential regulation of distinct Vps34 complexes by AMPK in nutrient stress and autophagy.Cell. 2013; 152: 290-303Abstract Full Text Full Text PDF PubMed Scopus (555) Google Scholar). Moreover, AMPK indirectly activates autophagy by suppressing the activity of the mammalian target of rapamycin (mTOR) complex 1, whose high activity prevents the activation of ULK1 by phosphorylating ULK1 at Ser757 and disrupts the interaction between ULK1 and AMPK (25Kim J. Kundu M. Viollet B. Guan K.L. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1.Nat. Cell Biol. 2011; 13: 132-141Crossref PubMed Scopus (4513) Google Scholar). Interestingly, the role of CD36 in enhancing fatty acid oxidation appears to be linked to CD36 AMPK interregulation (27Abumrad N.A. Goldberg I.J. CD36 actions in the heart: lipids, calcium, inflammation, repair and more?.Biochim. Biophys. Acta. 2016; 1861: 1442-1449Crossref PubMed Scopus (67) Google Scholar). CD36 was shown to be important for coordinating the dynamic protein interactions within a molecular complex consisting of the CD36 partner tyrosine kinase Fyn, the AMPK kinase LKB1, and AMPK. CD36 expression maintains AMPK quiescence by allowing Fyn to access and phosphorylate LKB1, promoting its nuclear sequestration away from AMPK. LCFA binding to CD36 activates AMPK within minutes via its ability to dissociate Fyn from the complex as CD36 is internalized into LKB1-rich vesicles. An earlier work from our group found that CD36 translocation to the plasma membrane of hepatocytes was associated with low AMPK activity and accompanied by low hepatic fatty acid oxidation, which may also result from the increased LKB1 phosphorylation (11Zhao L. Zhang C. Luo X. Wang P. Zhou W. Zhong S. Xie Y. Jiang Y. Yang P. Tang R. CD36 palmitoylation disrupts free fatty acid metabolism and promotes tissue inflammation in non-alcoholic steatohepatitis.J. Hepatol. 2018; 69: 705-717Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). These studies lead to the reasonable speculation that CD36 may be associated with autophagy through the AMPK pathway. In this study, we aimed to investigate the regulatory action of CD36 in autophagy/lipophagy and its underlying molecular mechanism in vitro and in vivo. Our results demonstrate that the hepatocyte CD36 has a negative role in the regulation of lipophagy through an AMPK-dependent pathway. This suggests that correction of the autophagy deficiency by ameliorating CD36 expression in hepatocytes may be a novel strategy for the treatment of NAFLD. Palmitic acid (PA) (Sigma-Aldrich, St. Louis, MO) was dissolved in 10% BSA with a stock concentration of 5 mM, aliquoted, and stored at −20°C. Chloroquine (CQ) (Sigma-Aldrich) inhibits lysosomal acidification and therefore prevents autophagy by blocking autophagosome fusion and degradation, which was dissolved in double-distilled water with a stock concentration of 50 mM and stored at 4°C. Wortmannin (Sigma-Aldrich), a phosphoinositide 3-kinase (PI3K) inhibitor, was dissolved in DMSO with a stock concentration of 400 µM at −80°C. Compound C (CC) (Selleck Chemicals, Houston, TX) was dissolved in DMSO and stored at −80°C. BODIPY 492/502 (Invitrogen, Carlsbad, CA) was dissolved in DMSO and stored at −20°C. LysoTracker was purchased from Life Technology (Grand Island, NY). Hepatocytes (HepG2 and Huh7 cells) were maintained in DMEM (HyClone, Logan, UT) supplemented with 10% FBS (Natocor, Corcovado, Argentina). Cells were cultured at 37°C in a humidified atmosphere with 5% CO2 (v/v). HepG2 and Huh7 stable cell lines were constructed with the lentivirus constructs, including GV341 empty vector and GV341 vector containing CD36, respectively. Stable cell lines were also cultured according to the abovementioned methods. Western blotting, quantitative PCR (qPCR), immunofluorescence, lipid droplet staining, and autophagic flux analysis in cells were performed following treatment with 0.5 mM PA for 24 h. CD36−/− mice created on a C57BL/6J background were provided by Maria Febbraio (Lerner Research Institute, Cleveland, OH). Eight-week-old male C57BL/6J or CD36−/− mice were fed a normal chow diet (NCD; n = 6) or high-fat diet (HFD; n = 6) for 14 weeks. In the experiment of reconstructing CD36 expression in CD36−/− mice, the 8-week-old male CD36−/− mice were injected with lentivirus empty vector (n = 6) or lentivirus vector containing CD36 (n = 6) in the tail vein and kept on the HFD for 8 weeks. All mice were housed in a temperature-controlled environment and on a 12 h light/dark cycle with free access to diet and water. Before being euthanized, mice with free access to water were deprived of food overnight. Animal treatment conformed to the guidelines of the Institutional Animal Care and Use Committee of Chongqing Medical University. All animals received care according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Knockdown of CD36 in HepG2 cells was achieved by using a reverse siRNA transfection procedure performed in six-well plates. Therefore, for each well to be transfected, 5 μl Lipofectamine RNAiMAX (Thermo Fisher Scientific, Eugene, OR) were mixed with 500 μl Opti-MEM (Thermo Fisher Scientific) and combined with 25 pmol siRNA (GenePharma, Shanghai, China). The transfection mixture was incubated at room temperature for 20 min. HepG2 cells were harvested in complete growth medium without antibiotics and diluted so that 2 ml contained the appropriate number of cells to give 30% to 50% confluence 24 h after plating. Cell suspensions were mixed with the transfection mixture and incubated. CD36-knockdown Huh7 cells were achieved by using a forward transfection procedure according to the product specification. Cells and mouse liver tissue were lysed with RIPA lysis buffer. Whole-cell extracts containing 30 μg protein per lane were dissolved on an 8% or 12% acrylamide gel and blotted wetly onto a PVDF membrane (Immobilon-P; 0.2 or 0.45 μm; Merck Millipore, Darmstadt, Germany). Membranes were blocked with 3% BSA for 1 h at room temperature and probed with specific antibodies overnight at 4°C [anti-LC3B: 1:2000 (Sigma-Aldrich); anti-p62: 1:5000 (Abcam, Cambridge, UK); anti-CD36: 1:2000 (Novus Biologicals, Centennial, CO); anti-CPT1a: 1:1000 (Proteintech, Rosemont, IL); anti-AMPK: 1:1000 (CST, Danvers, MA); anti-Phospho-AMPKα (Thr172): 1:1000 (CST); anti-LKB1: 1:3000 (Abcam); anti-mTOR: 1:1000 (CST); anti-Phospho-mTOR (Ser2448): 1:1000 (CST); anti-FOXO1: 1:500 (Merck Millipore); anti-Phospho-FOXO1 (Ser256): 1:1000 (CST); anti-ATG7: 1:1000 (CST); anti-ULK1: 1:1000 (CST); anti-Phospho-ULK1 (Ser555): 1:1000 (CST); anti-Beclin1: 1:1000 (CST); anti-Phospho-Beclin1 (Ser93): 1:1000 (CST); and anti-β actin: 1:3000 (Proteintech)]. Detection was achieved by using appropriate HRP-conjugated secondary antibodies (1:8000; Proteintech) in conjunction with the ECL reagent (Clarity Western ECL; Bio-Rad Laboratories, Hercules, CA). Afterwards, membranes were exposed, and signals were quantified using an Image Analyzer. Cells were seeded on glass coverslips prior to treatment. Following treatment, cells were washed in PBS, fixed for 25 min in 4% formaldehyde, and washed three times. Cells were then permeabilized in 100% methanol at −20°C for 10 min, washed, and blocked in normal goat serum for 1 h. Cells were then incubated with primary antibody overnight at 4°C, washed with PBS, and then incubated for 2 h at room temperature with fluorescence-conjugated secondary antibodies. Cells were washed three times and then treated with DAPI for 5 min. This was followed by three washes with PBS. For experiments involving lipid droplet staining, cells were stained with a fluorescent lipid dye, BODIPY 492/502, at a 1:1000 dilution for 30 min at room temperature before DAPI staining. Coverslips were visualized using a Leica confocal microscope. HepG2 or Huh7 cells were treated with siCD36 or siNeg and grown for 72 h. During the last 24 h of incubation prior to the experiment, the cells were either untreated or treated with 10 µM CQ. Autophagy was assessed by combinatory detection of the autophagosome formation marker LC3II, along with p62. In another experiment to detect autophagic flux, HepG2 cells were first transduced with siCD36 or siNeg in a confocal dish. Twenty-four hours after the first transduction, the cells were then transduced with monomeric red fluorescent protein (mRFP)-GFP-LC3 adenoviral vectors (HanBio Technology, Shanghai, China). The principle of the assay is based on the different pH stability of red and green fluorescent proteins. The enhanced GFP signal could be quenched under the acidic condition (pH <5) inside the lysosome, whereas the mRFP signal did not change significantly in acidic conditions. In red- and green-merged images, autophagosomes are shown as yellow puncta, while autolysosomes are shown as red puncta. An enhancement of both yellow and red puncta in cells indicate that autophagic flux is increased, while autophagic flux is blocked when only yellow puncta are increased without alteration of red puncta, or when both yellow and red puncta are decreased in cells (28Yu T. Guo F. Yu Y. Sun T. Ma D. Han J. Qian Y. Kryczek I. Sun D. Nagarsheth N. Chen Y. Chen H. Hong J. Zou W. Fang J.Y. Fusobacterium nucleatum promotes chemoresistance to colorectal cancer by modulating autophagy.Cell. 2017; 170: 548-563.e516Abstract Full Text Full Text PDF PubMed Scopus (925) Google Scholar, 29Zhou C. Zhong W. Zhou J. Sheng F. Fang Z. Wei Y. Chen Y. Deng X. Xia B. Lin J. Monitoring autophagic flux by an improved tandem fluorescent-tagged LC3 (mTagRFP-mWasabi-LC3) reveals that high-dose rapamycin impairs autophagic flux in cancer cells.Autophagy. 2012; 8: 1215-1226Crossref PubMed Scopus (181) Google Scholar). HepG2 cells were incubated in 1 ml growth medium with the adenoviruses for 2 h at 37°C, and the growth medium was replaced with fresh medium. Experiments were performed 48 h after the second transduction. LC3 puncta were examined with a Leica confocal microscope. Fresh tissue was placed in 4% glutaraldehyde overnight at 4°C. Ultrathin sections were cut and then stained. Images were acquired on a transmission electron microscope. For the quantification of autophagy, autophagic vacuoles (defined as autophagosomes, double-membraned structures surrounding cytoplasmic material, and autolysosomes, lysosomes containing cytoplasmic material) were counted. Oxygen consumption was measured on a Seahorse XF24 analyzer at 37°C. The Seahorse XF Cell Mito Stress Test Kit, XFe24 FluxPak mini, and XF Base Medium were purchased from Agilent Technologies (Santa Clara, CA). Forty-eight hours before assays, 40,000 cells of siCD36- or siNeg-treated HepG2 cells were seeded on a Seahorse XF24 analyzer plate. To study the effects of fat treatment on cells, media were replaced with 0.2% BSA and 0.5 mM PA 24 h before analysis. On the day of the assay, media were replaced with the Seahorse assay media. The oxygen consumption rate was measured in the basal state and after oligomycin treatment, FCCP treatment, and rotenone/antimycin A treatment. Basal respiration and maximal respiration were calculated respectively. ATP production was calculated by subtracting the minimum rate measurement after oligomycin injection from the last rate measurement in the basal state. Following the assay, cells were lysed, and protein content was taken for normalization. The assay was performed with a TG assay kit according to the manufacturer's instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Prior to treatment, cells were seeded on glass coverslips. Following treatment, cells were washed in PBS, fixed for 15 min in precooled acetone, and washed three times. Cells were then permeabilized in 0.5% Triton X-100 for 10 min and washed. Endogenous peroxidases were inactivated using 3% H2O2, followed by blocking with goat serum. Cells were incubated overnight at 4°C with transcription factor EB (TFEB) antibody (1:100; Proteintech). Cells were then washed and incubated for 45 min with secondary antibody. Cytochemical reactions were performed using a diaminobenzidine kit, and cells were counterstained with hematoxylin. Images were captured using a Zeiss microscope (Jena, Germany). Total RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. Then, 1 μg total RNA was reverse-transcribed to obtain cDNA using PrimeScript RT Reagent Kit (TaKaRa, Kusatsu, Japan) according to the manufacturer's protocol. qPCR was performed using SYBR Green PCR Mix kit (TaKaRa). Specific primer sequences used for qPCR are listed in Table 1. The housekeeping gene of β-actin was used for normalization in cultured cells, whereas 18 s ribosomal RNA expression was used for normalization in mouse liver tissue. Fold change was calculated using 2−ΔΔCt.TABLE 1qPCR primer sequencesGenesSequencesHuman CD36Forward: 5′- CTTTGGCTTAATGAGACTGGGAC -3′Reverse: 5′- GCAACAAACATCACCACACCA -3′Human ULK1Forward: 5′- AGCACGATTTGGAGGTCGC-3′Reverse: 5′- GCCACGATGTTTTCATGTTTCA-3′Human Beclin1Forward: 5′- CTCCTGGGTCTCTCCTGGTT-3′Reverse: 5′- TGGACACGAGTTTCAAGATCC-3′Human Atg5Forward: 5′- ACTGTCCATCTGCAGCCAC -3′Reverse: 5′- TGCAGAAGAAAATGGATTTCG -3′Human Atg7Forward: 5′- ATTGCTGCATCAAGAAACCC -3′Reverse: 5′- GAGAAGTCAGCCCCACAGC -3′Human Atg12Forward: 5′- CCATCACTGCCAAAACACTC -3′Reverse: 5′- TTGTGGCCTCAGAACAGTTG -3′Human Atg16l1Forward: 5′- AACGCTGTGCAGTTCAGTCC -3′Reverse: 5′- AGCTGCTAAGAGGTAAGATCCA -3′Human Atg16l2Forward: 5′- TGGACAAGTTCTCAAAGAAGCTG -3′Reverse: 5′- CCTCAGTGCGACCAGTGAT -3′Human FOXO1Forward: 5′-TCGTCATAATCTGTCCCTACACA -3′Reverse: 5′-CGGCTTCGGCTCTTAGCAAA -3′Human β-actinForward: 5′-GTTGTCGACGACGAGCG -3′Reverse: 5′-GCACAGAGCCTCGCCTT -3′Mouse ULK1Forward: 5′- AAGTTCGAGTTCTCTCGCAAG-3′Reverse: 5′- ACCTCCAGGTCGTGCTTCT-3′Mouse Beclin1Forward: 5′-GGCGAGTTTCAATAAATGGC-3′Reverse: 5′-CCAGGAACTCACAGCTCCAT-3′Mouse CPT1aForward: 5′-TGGCATCATCACTGGTGTGTT-3′Reverse: 5′-GTCTAGGGTCCGATTGATCTTTG-3′Mouse 18sRNAForward: 5′- TCGAGGCCCTGTAATTGGAA-3′Reverse: 5′- CCCTCCAATGGATCCTCGTT-3′ Open table in a new tab All cell culture experiment data represent at least three independent experiments and are expressed as means ± SDs. The difference between two groups was statistically analyzed using Student's t-test in GraphPad Prism version 5. Statistical tests of significance are given in the figure legends. Eight-week-old C57BL/6 mice were fed the HFD for 14 weeks to induce the NAFLD model. Hematoxylin and eosin staining and Oil Red O staining showed evident steatosis in the livers of mice fed the HFD compared with the NCD (Fig. 1A). TG and free fatty acid contents were significantly higher in the livers of mice fed the HFD compared with those fed the NCD (Fig. 1B). To determine CD36 expression and the status of autophagy in NAFLD, we performed Western blotting to detect CD36 and LC3II in mice with liver steatosis and corresponding controls and found that the expression of CD36 was increased and LC3II level was significantly reduced in the mice with liver steatosis. Furthermore, we observed an increase in the protein levels of SQSTM1/p62, one of the selective substrates of autophagy, which was commonly used as a marker of autophagic flux (Fig. 1C). These data suggested that there may be a negative correlation between the expression of CD36 and autophagy in vivo. Next, we transfected HepG2 and Huh7 cells with siCD36s to knock down CD36 expression and observed an increase in LC3II protein and a decrease in p62 level under the PA treatment conditions (Fig. 2A, B). We also observed an increase in LC3II protein and a decrease in p62 level after downregulating the CD36 expression in the HepG2 cells without PA treatment (s