MICU3 Plays an Important Role in Cardiovascular Function

HomeCirculation ResearchVol. 127, No. 12MICU3 Plays an Important Role in Cardiovascular Function Free AccessLetterPDF/EPUBAboutView PDFView EPUBSections ToolsAdd to favoritesDownload citationsTrack citationsPermissions ShareShare onFacebookTwitterLinked InMendeleyRedditDiggEmail Jump toFree AccessLetterPDF/EPUBMICU3 Plays an Important Role in Cardiovascular Function Bao N. Puente, Junhui Sun, Randi J. Parks, Maria M. Fergusson, Chengyu Liu, Danielle A. Springer, Angel M. Aponte, Julia C. Liu, Elizabeth Murphy Bao N. PuenteBao N. Puente Department of Pediatrics, Division of Cardiac Critical Care, Children’s National Health System, Washington DC (B.N.P.). Cardiovascular Branch (B.N.P., J.S., R.J.P., M.M.F., J.C.L., E.M.), National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD. Search for more papers by this author , Junhui SunJunhui Sun Cardiovascular Branch (B.N.P., J.S., R.J.P., M.M.F., J.C.L., E.M.), National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD. Search for more papers by this author , Randi J. ParksRandi J. Parks Cardiovascular Branch (B.N.P., J.S., R.J.P., M.M.F., J.C.L., E.M.), National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD. Search for more papers by this author , Maria M. FergussonMaria M. Fergusson Cardiovascular Branch (B.N.P., J.S., R.J.P., M.M.F., J.C.L., E.M.), National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD. Search for more papers by this author , Chengyu LiuChengyu Liu Transgenic Core (C.L.), National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD. Search for more papers by this author , Danielle A. SpringerDanielle A. Springer Phenotyping Core (D.A.S.), National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD. Search for more papers by this author , Angel M. AponteAngel M. Aponte https://orcid.org/0000-0001-5684-2715 Proteomics Core (A.M.A.), National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD. Search for more papers by this author , Julia C. LiuJulia C. Liu Julia C. Liu, PhD, Cancer and Cardiovascular Research Bldg, 2231 6th St SE, Minneapolis, MN 55455, Email E-mail Address: [email protected] Cardiovascular Branch (B.N.P., J.S., R.J.P., M.M.F., J.C.L., E.M.), National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD. Department of Integrative Biology and Physiology, University of Minnesota Medical School, Minneapolis (J.C.L.). *J.C.L. and E.M. are co-senior authors. Search for more papers by this author , Elizabeth MurphyElizabeth Murphy Correspondence to: Elizabeth Murphy, PhD, Cardiovascular Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bldg 10, MS 1770, 10 Center Dr, Bethesda, MD, Email E-mail Address: [email protected] https://orcid.org/0000-0001-9400-0797 Cardiovascular Branch (B.N.P., J.S., R.J.P., M.M.F., J.C.L., E.M.), National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD. *J.C.L. and E.M. are co-senior authors. Search for more papers by this author Originally published16 Oct 2020https://doi.org/10.1161/CIRCRESAHA.120.317177Circulation Research. 2020;127:1571–1573is related toMeet the First AuthorsMeet the First Author, see p 1472Mitochondrial calcium regulates bioenergetics but also serves as a trigger for cell death.1 With a sustained increase in catecholamine or a large increase in cytosolic calcium as occurs with ischemia, mitochondrial calcium can rise to high levels, leading to activation of the mitochondrial permeability transition pore, thus initiating cell death.1 Calcium uptake into mitochondria occurs via the MCU (mitochondrial calcium uniporter), which is regulated by 3 EF (EF hand protein) hand proteins, MICU (mitochondrial calcium uptake) 1, 2, and 3.2 MICU1/MCU ratios vary in different tissues,3 and alterations in substrate flux have been shown to regulate MICU1 levels altering MCU-mediated calcium uptake.4 MICU3 has generally been thought to function primarily in neuronal tissue where it is highly expressed and thus has been largely ignored in other tissues such as the heart. We performed quantitative proteomics using Tandem mass tag labeling coupled to liquid chromatography and tandem mass spectrometry to analyze MCU and MCU regulators in cardiac and hepatic mitochondria (Figure [A]). Normalizing MICU levels to MCU in heart and liver mitochondria, we found that the MICU1/MCU ratio was 0.75 in liver and 0.25 in heart, which is consistent with previous studies3; however, the MICU3/MCU ratio in heart is >3-fold higher than that found in liver. To confirm that the MICU3 we observed in heart mitochondria was not due to contamination by mitochondria from nerve tissue in heart, we isolated cardiomyocytes and compared the ratio of MICU3 to MCU in cardiomyocytes and heart mitochondria and found similar ratios (Figure [B]). These data suggest that MICU3 might play a role in regulating MCU in heart.Download figureDownload PowerPointFigure. MICU3 regulates cardiovascular function.A, Proteomic analysis of MCU (mitochondrial calcium uniporter) regulators in hepatic and cardiac mitochondria (n=5). B, Western blot showing MICU (mitochondrial calcium uptake) 3 normalized to MCU in adult WT mitochondria and cardiomyocytes (top). Western blot from cardiomyocytes isolated from adult WT and Micu3−/− mice demonstrating no MICU3 expression in Micu3−/− cardiomyocytes (bottom). C, CRISPR (clustered regularly interspaced short palindromic repeats)-mediated targeted deletion of exons 1 to 12 of the Micu3 gene. Exons 1 through 14 encompass the coding sequence, whereas exon 15 is noncoding. The scissors indicate the targeting sites for the CRISPR short guide RNAs (protospacer adjacent motif [PAM] sequences underlined), which were CGGCTCCCGGGATGTCGGGCCGG (exon 1) and CGTGCTGTATACGTAGCTACTGG (exon 12). D, Fractional shortening (FS), ejection fraction (EF), and left ventricular end diastolic dimension (LVDd) at baseline and after 2 wk of isoproterenol treatment in Micu3−/− vs WT mice. There was no sex difference (circles and triangles represent males and females, respectively). After confirming normal distribution, significance was determined by ANOVA followed by Tukey to obtain corrected P; n=16 for baseline, and n=13 for isoproterenol. E, Quantitated densitometry ratio of phosphorylated PDH (pyruvate dehydrogenase) to total PDH from hearts of Micu3−/− (n=7) and WT (n=7) exposed to 2 wk of isoproterenol infusion. F, Quantitated rate pressure product and infarct size assessment by TTC (triphenyltetrazolium chloride) staining post-reperfusion between Micu3−/− (n=4) and WT (n=4) hearts subjected to I/R (ischemia/reperfusion) injury using Langendorff ex vivo perfusion. There were no significant differences in preischemic function (heart rate or left ventricular developed pressure) between WT and Micu3−/− hearts. Error bars represent SEM. Mann-Whitney U test was used to determine significance in E and F CM indicates cardiomyocytes.To examine the physiological function of MICU3, we generated 2 independent mouse lines with global deletion of MICU3 (Micu3−/−) utilizing CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats/clustered regularly interspaced short palindromic repeat–associated 9) methods. By co-microinjecting sgRNAs targeting exons 1 and 12 (Figure [C]), we created 2 mutant lines, 1 with a small frameshift deletion in exon 1 and the other with the entire region between exons 1 and 12 deleted. The mice were viable, and there were no gross differences in adult Micu3−/− mice compared with WT littermates. MICU3 protein expression was not present in Micu3−/− cardiomyocytes (Figure [B]). Preliminary results showed no significant differences between the two lines, thus subsequent studies were focused on the line with deletion of exons 1 to 12. MCU, MICU1, and NCLX (sodium, calcium, lithium exchanger) protein levels were similar between the WT and Micu3−/− mice. Echocardiograms showed no significant baseline differences in heart rate, fractional shortening, or ejection fraction between WT and Micu3−/− mice. MICU3 has been shown to facilitate MICU1-mediated progressive channel activation by calcium.5 As sustained mitochondria calcium overload associated with long-term isoproterenol treatment has been suggested to lead to hypertrophy and cardiac dysfunction, we tested the hypothesis that Micu3−/− mice would have less dysfunction following isoproterenol-induced hypertrophy. Both sexes of adult (8–17 weeks) Micu3−/− and WT littermate mice were treated with continuous infusion of isoproterenol (15 mg/kg per day) via an osmotic minipump for 2 weeks. Echocardiograms were performed at baseline and after treatment to assess changes in cardiac dimensions and function. Whereas WT mice exhibited depressed function (fractional shortening and ejection fraction) after 2 weeks of treatment with isoproterenol, Micu3−/− mice demonstrated normal function.Correspondingly, WT mice developed left ventricular dilation from baseline, whereas left ventricular dimension remained stable in Micu3−/− mice (Figure [D]). To determine whether loss of MICU3 protected hearts from isoproterenol-induced mitochondrial calcium overload, after 2 weeks of isoproterenol treatment, we assessed levels of phosphorylated PDH (pyruvate dehydrogenase). Micu3−/− hearts exhibited elevated phosphorylated PDH, which has been demonstrated to be inversely proportional to mitochondrial calcium level, indicating lower mitochondrial calcium relative to WT hearts (Figure [E]).As cardiac injury after ischemia-reperfusion is thought to be associated with increased mitochondrial calcium leading to mitochondria-initiated cell death, we tested whether Micu3−/− hearts were protected against ischemia-reperfusion injury. Ex vivo Langendorff-perfused hearts from WT and Micu3−/− mice were subjected to 20 minutes of global ischemia followed by 90 minutes of reperfusion. Micu3−/− hearts had reduced infarct size normalized to the entire left ventricle and improved contractile function following reperfusion (Figure [F]). Protection in ex vivo Micu3−/− hearts strongly supports a role for MICU3 in cardiac mitochondria. Interestingly, germline ablation of MCU or EMRE (essential MCU regulator) was not cardioprotective, likely due to adaptations in these germline knockout mice. We speculate that loss of MICU3 does not lead to adaptation, and under conditions of prolonged elevated calcium, the loss of MICU3 is protective.Our results show that loss of MICU3 confers cardioprotection against ischemia-reperfusion injury and isoproterenol-induced cardiac dysfunction. MICU3 levels relative to MCU and MICU1 are higher in heart than in liver, and loss of MICU3 reduces calcium overload during sustained isoproterenol treatment. Taken together, these data support the novel finding that MICU3 plays an important role in regulating pathological calcium overload in the heart.Data AvailabilityThe data that support the findings of this study are available from the corresponding author upon reasonable request.Nonstandard Abbreviations and AcronymsCRISPR-Cas9clustered regularly interspaced short palindromic repeats/clustered regularly interspaced short palindromic repeat–associated 9MCUmitochondrial calcium uniporterMICUmitochondrial calcium uptakePDHpyruvate dehydrogenaseSources of FundingStudies were funded by the National Heart, Lung, and Blood Institute intramural program. J.C. Liu was supported by 1K22HL137901.DisclosuresNone.FootnotesThis manuscript was sent to Joyce Bischoff, Consulting Editor, for review by expert referees, editorial decision, and final disposition.*J.C.L. and E.M. are co-senior authors.For Sources of Funding and Disclosures, see page 1572.Correspondence to: Elizabeth Murphy, PhD, Cardiovascular Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bldg 10, MS 1770, 10 Center Dr, Bethesda, MD, Email [email protected]nih.govJulia C. Liu, PhD, Cancer and Cardiovascular Research Bldg, 2231 6th St SE, Minneapolis, MN 55455, Email [email protected]eduReferences1. Bauer TM, Murphy E. Role of mitochondrial calcium and the permeability transition pore in regulating cell death.Circ Res. 2020; 126:280–293. doi: 10.1161/CIRCRESAHA.119.316306LinkGoogle Scholar2. Plovanich M, Bogorad RL, Sancak Y, Kamer KJ, Strittmatter L, Li AA, Girgis HS, Kuchimanchi S, De Groot J, Speciner L, et al.. MICU2, a paralog of MICU1, resides within the mitochondrial uniporter complex to regulate calcium handling.PLoS One. 2013; 8:e55785. doi: 10.1371/journal.pone.0055785CrossrefMedlineGoogle Scholar3. Paillard M, Csordás G, Szanda G, Golenár T, Debattisti V, Bartok A, Wang N, Moffat C, Seifert EL, Spät A, et al.. Tissue-specific mitochondrial decoding of cytoplasmic Ca2+ signals is controlled by the stoichiometry of MICU1/2 and MCU.Cell Rep. 2017; 18:2291–2300. doi: 10.1016/j.celrep.2017.02.032CrossrefMedlineGoogle Scholar4. Nemani N, Dong Z, Daw CC, Madaris TR, Ramachandran K, Enslow BT, Rubannelsonkumar CS, Shanmughapriya S, Mallireddigari V, Maity S, et al.. Mitochondrial pyruvate and fatty acid flux modulate MICU1-dependent control of MCU activity.Sci Signal. 2020; 13:eaaz6206.CrossrefMedlineGoogle Scholar5. Patron M, Granatiero V, Espino J, Rizzuto R, De Stefani D. MICU3 is a tissue-specific enhancer of mitochondrial calcium uptake.Cell Death Differ. 2019; 26:179–195. doi: 10.1038/s41418-018-0113-8CrossrefMedlineGoogle Scholar Previous Back to top Next FiguresReferencesRelatedDetailsRelated articlesMeet the First AuthorsCirculation Research. 2020;127:1470-1472 December 4, 2020Vol 127, Issue 12Article InformationMetrics Download: 460 © 2020 American Heart Association, Inc.https://doi.org/10.1161/CIRCRESAHA.120.317177PMID: 33059536 Originally publishedOctober 16, 2020 Keywordshypertrophycalcium channelsreperfusion injurymitochondriacalciumPDF download SubjectsPhysiologyIschemia