摘要
HomePlant DiseaseVol. 103, No. 11First Report of Tomato brown rugose fruit virus Infecting Tomato in China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Tomato brown rugose fruit virus Infecting Tomato in ChinaZ.-Y. Yan, H.-Y. Ma, S.-L. Han, C. Geng, Y.-P. Tian, and X.-D. LiZ.-Y. YanLaboratory for Plant Virology, Department of Plant Pathology, College of Plant Protection, Shandong Agricultural University, Tai’an, Shandong 271018, ChinaSearch for more papers by this author, H.-Y. MaLaboratory for Plant Virology, Department of Plant Pathology, College of Plant Protection, Shandong Agricultural University, Tai’an, Shandong 271018, ChinaSearch for more papers by this author, S.-L. HanLaboratory for Plant Virology, Department of Plant Pathology, College of Plant Protection, Shandong Agricultural University, Tai’an, Shandong 271018, ChinaSearch for more papers by this author, C. GengLaboratory for Plant Virology, Department of Plant Pathology, College of Plant Protection, Shandong Agricultural University, Tai’an, Shandong 271018, ChinaSearch for more papers by this author, Y.-P. Tianhttp://orcid.org/0000-0002-3452-2013Laboratory for Plant Virology, Department of Plant Pathology, College of Plant Protection, Shandong Agricultural University, Tai’an, Shandong 271018, ChinaSearch for more papers by this author, and X.-D. Li†Corresponding author: X.-D. Li; E-mail Address: xdongli@sdau.edu.cnhttp://orcid.org/0000-0001-9838-0045Laboratory for Plant Virology, Department of Plant Pathology, College of Plant Protection, Shandong Agricultural University, Tai’an, Shandong 271018, ChinaSearch for more papers by this authorAffiliationsAuthors and Affiliations Z.-Y. Yan H.-Y. Ma S.-L. Han C. Geng Y.-P. Tian X.-D. Li † Laboratory for Plant Virology, Department of Plant Pathology, College of Plant Protection, Shandong Agricultural University, Tai’an, Shandong 271018, China Published Online:13 Sep 2019https://doi.org/10.1094/PDIS-05-19-1045-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Tomato (Solanum lycopersicum L.) is an important vegetable crop worldwide. In April 2019, tomato plants showing brown rugose symptom in their fruits and mild mosaic symptom in their leaves were found in three tomato greenhouses (∼1 acre) in Yucheng, Shandong Province, China. The incidence of diseased plants was estimated at about 50%. Sixteen samples were collected and analyzed for virus infection through Western blot and enzyme-linked immunosorbent assay using a tobacco mosaic virus (TMV) specific antibody produced in our laboratory previously (Fan et al. 1999). Results showed that all the samples reacted positively with this antibody, implying that these samples may be infected by TMV or a virus serologically related to TMV. We then selected four out of the 16 samples randomly and conducted reverse transcription polymerase chain reaction (RT-PCR) using primers specific for TMV (Kumar et al. 2011), tobacco mild green mosaic virus, tomato mottle mosaic virus, and tomato mosaic virus (Liu et al. 2019). Results showed that no positive reaction was obtained using these four PCR primer sets. When a set of primers specific to tomato brown rugose fruit virus (ToBRFV) (ToBRFV-1534-F, AGATTTCCCTGGCTTTTGGA; and ToBRFV-3733-R, ATCATCGCCACCAAATTTTC) (Luria et al. 2017) was used in the RT-PCR, an expected size of PCR product (∼2.2 kb) was amplified from all four samples. DNA sequencing of the amplicon further confirmed that the virus infecting these four samples was an isolate of ToBRFV (referred to as ToBRFV Shandong isolate or ToBRFV-SD thereafter). The sequence of ToBRFV-SD is now deposited at the NCBI database under the accession number MK905890. BLAST analysis showed that the sequence shared nucleotide identities of 99.91 and 99.86% with those of ToBRFV Israel isolate (KX619418; Luria et al. 2017) and ToBRFV Jordan isolate (KT383474; Salem et al. 2016), respectively. We then analyzed the remaining 12 samples through RT-PCR using primers ToBRFV-1534-F and ToBRFV-3733-R. The results showed that these 12 samples also contained ToBRFV. Biological assays showed that ToBRFV-SD could be mechanically transmitted to Nicotiana benthamiana and tomato cultivar ‘Jinpeng No. 1’. By 10 days after virus inoculation, the inoculated tomato plants showed narrow leaves with mild mosaic symptoms, whereas the inoculated N. benthamiana plants showed leaf lesion and plant collapse, similar to that reported previously (Luria et al. 2017). Analysis of these inoculated plants through RT-PCR confirmed that these plants were indeed infected with ToBRFV-SD. The phosphate buffer-inoculated N. benthamiana or tomato plants did not show any virus-like symptoms. Since the first report of ToBRFV in Jordan (Salem et al. 2016), this emerging virus has been detected in Germany (Menzel et al. 2019), Israel (Luria et al. 2017), Italy (Panno et al. 2019), Mexico (Camacho-Beltran et al. 2019), Palestine (Alkowni et al. 2019), and the United States (Ling et al. 2019). To our knowledge, this is the first report of ToBRFV in China. How ToBRFV-SD was introduced into China is unknown. Because ToBRFV can be transmitted by mechanical wounding, seeds, bumblebee (Bombus terrestris), and human activities in field, the most economical and effective way to control this virus is to grow resistant tomato plants. To date, commercial tomato cultivars resistant to this virus in Asia have yet to be identified. The finding presented in this report should prompt us to conduct further studies on this virus and to establish a control strategy to prevent the further spread of ToBRFV in China.The author(s) declare no conflict of interest.References:Alkowni, R., et al. 2019. J. Plant Pathol. doi: 10.1007/s42161-019-00240-7. Google ScholarCamacho-Beltran, E., et al. 2019. Plant Dis. 103:1440. https://doi.org/10.1094/PDIS-11-18-1974-PDN Link, ISI, Google ScholarFan, G., et al. 1999. J. Shandong Agric. Univ. 30:249. Google ScholarKumar, S., et al. 2011. Lett. Appl. Microbiol. 53:359. https://doi.org/10.1111/j.1472-765X.2011.03117.x Crossref, ISI, Google ScholarLing, K.-S., et al. 2019. Plant Dis. 103:1439. https://doi.org/10.1094/PDIS-11-18-1959-PDN Link, ISI, Google ScholarLiu, Y., et al. 2019. Sci. Agric. Sin. 52:239. Google ScholarLuria, N., et al. 2017. PLoS One 12:e0170429. https://doi.org/10.1371/journal.pone.0170429 Crossref, ISI, Google ScholarMenzel, W., et al. 2019. New Dis. Rep. 39:1. https://doi.org/10.5197/j.2044-0588.2019.039.001 Crossref, Google ScholarPanno, S., et al. 2019. Plant Dis. 103:1443. https://doi.org/10.1094/PDIS-12-18-2254-PDN Link, ISI, Google ScholarSalem, N., et al. 2016. Arch. Virol. 161:503. https://doi.org/10.1007/s00705-015-2677-7 Crossref, ISI, Google ScholarThe author(s) declare no conflict of interest.Funding: Funding was provided by ‘Taishan Scholar’ Construction Project (grant no. TS201712023) and National Natural Science Foundation of China (grant nos. 31571984 and 31720103912).DetailsFiguresLiterature CitedRelated Vol. 103, No. 11 November 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionAdvanced symptoms of bacterial blotch disease on mushroom caps (Osdaghi et al.). Photo credit: C. Bull. Powdery mildew caused by Golovinomyces neosalviae on Salvia fruticosa (Soylu et al.). Photo credit: S. Soylu. Metrics Article History Issue Date: 4 Nov 2019Published: 13 Sep 2019First Look: 9 Jul 2019Accepted: 5 Jul 2019 Pages: 2973-2973 Information© 2019 The American Phytopathological SocietyFunding‘Taishan Scholar’ Construction ProjectGrant/Award Number: TS201712023National Natural Science Foundation of ChinaGrant/Award Number: 31571984Grant/Award Number: 31720103912Keywordsviruses and viroidsvegetablesetiology, tomato, ToBRFVThe author(s) declare no conflict of interest.Cited byDevelopment of a scale for assessment of disease severity and impact of tomato brown rugose fruit virus on tomato yield15 December 2022 | European Journal of Plant Pathology, Vol. 165, No. 3Solanum elaeagnifolium and S. rostratum as potential hosts of the tomato brown rugose fruit virus1 March 2023 | PLOS ONE, Vol. 18, No. 3Characterization of Tomato Brown Rugose Fruit Virus (ToBRFV) Detected in Czech Republic18 February 2023 | Diversity, Vol. 15, No. 2The Impact of Tobamovirus Infection on Root Development Involves Induction of Auxin Response Factor 10a in Tomato3 January 2022 | Plant and Cell Physiology, Vol. 63, No. 12Disinfectants Useful to Manage the Emerging Tomato Brown Rugose Fruit Virus in Greenhouse Tomato Production14 December 2022 | Horticulturae, Vol. 8, No. 12Decontamination of Tomato Brown Rugose Fruit Virus-Contaminated Shoe Soles under Practical Conditions17 December 2022 | Horticulturae, Vol. 8, No. 12Insight into Population Structure and Evolutionary Analysis of the Emerging Tomato Brown Rugose Fruit Virus28 November 2022 | Plants, Vol. 11, No. 23Comparison of Models for Quantification of Tomato Brown Rugose Fruit Virus Based on a Bioassay Using a Local Lesion Host9 December 2022 | Plants, Vol. 11, No. 24Comparative Analysis of Tomato Brown Rugose Fruit Virus Isolates Shows Limited Genetic Diversity17 December 2022 | Viruses, Vol. 14, No. 12Occurrence and Distribution of Tomato Brown Rugose Fruit Virus Infecting Tomato Crop in Saudi Arabia18 November 2022 | Plants, Vol. 11, No. 22Tomato brown rugose fruit virus : An emerging and rapidly spreading plant RNA virus that threatens tomato production worldwide22 May 2022 | Molecular Plant Pathology, Vol. 23, No. 9ToBRFV Infects the Reproductive Tissues of Tomato Plants but Is Not Transmitted to the Progenies by Pollination14 September 2022 | Cells, Vol. 11, No. 18New Weed Hosts for Tomato Brown Rugose Fruit Virus in Wild Mediterranean Vegetation1 September 2022 | Plants, Vol. 11, No. 17Effect of Plant Growth Promoting Microorganisms on Pepper Plants Infected with Tomato Brown Rugose Fruit Virus10 August 2022 | Diversity, Vol. 14, No. 8Cleaning of Tomato brown rugose fruit virus (ToBRFV) from Contaminated Clothing of Greenhouse Employees19 August 2022 | Horticulturae, Vol. 8, No. 8Toward a CRISPR-Based Point-of-Care Test for Tomato Brown Rugose Fruit Virus DetectionJoan Miquel Bernabé-Orts, Yolanda Hernando, and Miguel A. Aranda16 May 2022 | PhytoFrontiers™, Vol. 2, No. 2Viruses of Economic Impact on Tomato Crops in Mexico: From Diagnosis to Management—A Review9 June 2022 | Viruses, Vol. 14, No. 6Development of a droplet digital polymerase chain reaction (ddPCR) assay for the detection of Tomato brown rugose fruit virus (ToBRFV) in tomato and pepper seedsJournal of Virological Methods, Vol. 302Inter-Laboratory Comparison of RT-PCR-Based Methods for the Detection of Tomato Brown Rugose Fruit Virus on Tomato3 February 2022 | Pathogens, Vol. 11, No. 2Development and Validation of a One-Step Reverse Transcription Real-Time PCR Assay for Simultaneous Detection and Identification of Tomato Mottle Mosaic Virus and Tomato Brown Rugose Fruit Virus11 February 2022 | Plants, Vol. 11, No. 4Tomato brown rugose fruit virus (Tomato brown rugose fruit virus)CABI Compendium, Vol. CABI CompendiumLocalization and Mechanical Transmission of Tomato Brown Rugose Fruit Virus in Tomato SeedsN. M. Salem, A. Sulaiman, N. Samarah, M. Turina, and M. Vallino21 January 2022 | Plant Disease, Vol. 106, No. 1Detection of Tomato brown rugose fruit virus (ToBRFV) in solanaceous plants in Mexico5 July 2021 | Journal of Plant Diseases and Protection, Vol. 128, No. 6Effectiveness of disinfectants against the spread of tobamoviruses: Tomato brown rugose fruit virus and Cucumber green mottle mosaic virus6 January 2021 | Virology Journal, Vol. 18, No. 1Molecular characterization and pathogenicity of an infectious cDNA clone of tomato brown rugose fruit virus5 July 2021 | Phytopathology Research, Vol. 3, No. 1Preventive Effect of Lycopene in Dextran Sulfate Sodium-Induced Ulcerative Colitis Mice through the Regulation of TLR4/TRIF/NF-κB Signaling Pathway and Tight Junctions3 November 2021 | Journal of Agricultural and Food Chemistry, Vol. 69, No. 45Comparative Analysis of Host Range, Ability to Infect Tomato Cultivars with Tm-22 Gene, and Real-Time Reverse Transcription PCR Detection of Tomato Brown Rugose Fruit VirusBidisha Chanda, Andrea Gilliard, Namrata Jaiswal, and Kai-Shu Ling18 November 2021 | Plant Disease, Vol. 105, No. 11Identification of genetic determinants of tomato brown rugose fruit virus that enable infection of plants harbouring the Tm‐2 2 resistance gene13 August 2021 | Molecular Plant Pathology, Vol. 22, No. 11A Review of the Most Common and Economically Important Diseases That Undermine the Cultivation of Tomato Crop in the Mediterranean Basin29 October 2021 | Agronomy, Vol. 11, No. 11The Tomato Brown Rugose Fruit Virus Movement Protein Overcomes Tm-22 Resistance in Tomato While Attenuating Viral TransportHagit Hak and Ziv Spiegelman11 October 2021 | Molecular Plant-Microbe Interactions, Vol. 34, No. 9Full Issue PDF29 November 2021 | Molecular Plant-Microbe Interactions, Vol. 34, No. 9New Resources for the Specific and Sensitive Detection of the Emerging Tomato Brown Rugose Fruit Virus25 August 2021 | Viruses, Vol. 13, No. 9Biological and molecular characterization of tomato brown rugose fruit virus and development of quadruplex RT-PCR detectionJournal of Integrative Agriculture, Vol. 20, No. 7Tomato genetic resistance to tobamoviruses is compromisedActa Horticulturae, No. 1316Differential Detection of the Tobamoviruses Tomato Mosaic Virus (ToMV) and Tomato Brown Rugose Fruit Virus (ToBRFV) Using CRISPR-Cas12a21 June 2021 | Plants, Vol. 10, No. 6Global Advances in Tomato Virome Research: Current Status and the Impact of High-Throughput Sequencing21 May 2021 | Frontiers in Microbiology, Vol. 12Rapid and Sensitive Detection of Tomato Brown Rugose Fruit Virus in Tomato and Pepper Seeds by Reverse Transcription Loop-Mediated Isothermal Amplification Assays (Real Time and Visual) and Comparison With RT-PCR End-Point and RT-qPCR Methods21 April 2021 | Frontiers in Microbiology, Vol. 12Disinfection treatments eliminated tomato brown rugose fruit virus in tomato seeds31 October 2020 | European Journal of Plant Pathology, Vol. 159, No. 1Identification and Mapping of Tomato Genome Loci Controlling Tolerance and Resistance to Tomato Brown Rugose Fruit Virus19 January 2021 | Plants, Vol. 10, No. 1Tomato Brown Rugose Fruit Virus: Seed Transmission Rate and Efficacy of Different Seed Disinfection Treatments20 November 2020 | Plants, Vol. 9, No. 11Real-time tracking of Tomato brown rugose fruit virus (ToBRFV) outbreaks in the Netherlands using Nextstrain8 October 2020 | PLOS ONE, Vol. 15, No. 10Tomato Brown Rugose Fruit Virus Contributes to Enhanced Pepino Mosaic Virus Titers in Tomato Plants11 August 2020 | Viruses, Vol. 12, No. 8Complete Genome Sequence of a Tomato Brown Rugose Fruit Virus Isolated in the United StatesMicrobiology Resource Announcements, Vol. 9, No. 29Spread of Tomato Brown Rugose Fruit Virus in Sicily and Evaluation of the Spatiotemporal Dispersion in Experimental Conditions12 June 2020 | Agronomy, Vol. 10, No. 6The Potential Risk of Plant-Virus Disease Initiation by Infected Tomatoes14 May 2020 | Plants, Vol. 9, No. 5Tomato brown rugose fruit virus (ToBRFV): Güncel durumu ve geleceği1 April 2020 | Mediterranean Agricultural Sciences, Vol. 33, No. 1Novel targets for engineering Physostegia chlorotic mottle and tomato brown rugose fruit virus-resistant tomatoes: in silico prediction of tomato microRNA targets27 October 2020 | PeerJ, Vol. 8Tomato brown rugose fruit disease: current distribution, knowledge and future prospects16 October 2019 | Plant Pathology, Vol. 68, No. 9First report of Tomato brown rugose fruit virus in tomato in the United Kingdom24 September 2019 | New Disease Reports, Vol. 40, No. 1