Facile Synthesis of Oligodeoxyribonucleotides via the Phosphoramidite Method without Nucleoside Base Protection

A facile synthesis of oligodeoxyribonucleotides via the phosphoramidite approach without base protection of the building blocks has been developed; it relies on the use of imidazolium triflate as a promoter for the condensation of a nucleoside phosphoramidite and a nucleoside. In the solution phase, the condensation is accomplished in a highly O-selective manner by using equimolar amounts of an N-free nucleoside phosphoramidite and an N-unblocked nucleoside to give, after oxidation with bis(trimethylsilyl)peroxide or with tert- butyl hydroperoxide, a dinucleoside phosphate in >95% yield. In the solid-phase synthesis, which requires an excess amount of the phosphoramidite for the condensation, deoxyadenosine and deoxycytidine undergo N-phosphitylation to some extent. The undesired product, however, can be converted to the N-free derivative by brief treatment with benzimidazolium triflate in methanol. Thus the overall process allows the chemoselective formation of internucleotide linkage. The oligomers prepared by this N-unprotected solid-phase approach include 5 ‘ GTCACGACGTTGTAAAACGAC 3 ‘ (21mer), 5 ‘ CAGGAAACAG-CTATGACCATG 3 ‘ (21mer), 5 ‘ CAAGTTGATGAACAATACTTCATACCTAAACT 3 ‘ (32mer), and 5 ‘ TATGGGCCTTTTGATAGGATGCTCACCGAGCAAAACCAAGAACAA-CCAGGAGATTTTATT 3 ‘ (60mer), which are provided in excellent quality. PCR amplification of DNAs using the crude 21mers as primers is also demonstrated.